ID: 1036689936

View in Genome Browser
Species Human (GRCh38)
Location 8:10939040-10939062
Sequence GACCTTTTCCTGCTTCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036689930_1036689936 16 Left 1036689930 8:10939001-10939023 CCGCAAGAAATCCATCTGTCCCC 0: 1
1: 0
2: 1
3: 19
4: 429
Right 1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG No data
1036689935_1036689936 -5 Left 1036689935 8:10939022-10939044 CCGAACACTATCTGCAAGGACCT 0: 1
1: 0
2: 2
3: 10
4: 104
Right 1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG No data
1036689933_1036689936 -3 Left 1036689933 8:10939020-10939042 CCCCGAACACTATCTGCAAGGAC 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG No data
1036689931_1036689936 5 Left 1036689931 8:10939012-10939034 CCATCTGTCCCCGAACACTATCT 0: 1
1: 0
2: 2
3: 5
4: 88
Right 1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG No data
1036689934_1036689936 -4 Left 1036689934 8:10939021-10939043 CCCGAACACTATCTGCAAGGACC 0: 1
1: 0
2: 2
3: 5
4: 96
Right 1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036689936 Original CRISPR GACCTTTTCCTGCTTCTCCC AGG Intronic
No off target data available for this crispr