ID: 1036692977

View in Genome Browser
Species Human (GRCh38)
Location 8:10956404-10956426
Sequence CCTGCTTTGTATGGGGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036692977_1036692983 1 Left 1036692977 8:10956404-10956426 CCCAACACCCCATACAAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1036692983 8:10956428-10956450 ACTGCACCTACCCCTTAGAGAGG No data
1036692977_1036692988 14 Left 1036692977 8:10956404-10956426 CCCAACACCCCATACAAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1036692988 8:10956441-10956463 CTTAGAGAGGTTCCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036692977 Original CRISPR CCTGCTTTGTATGGGGTGTT GGG (reversed) Intronic
900338141 1:2174928-2174950 GCTGCTGTGTATCGGGTGTGTGG + Intronic
900696610 1:4015853-4015875 CCAGCTGTGTATATGGTGTTAGG - Intergenic
904397576 1:30232485-30232507 CCTGGTCTGTAGGGGGTGCTGGG - Intergenic
904462932 1:30691186-30691208 ACTGCTTTGTAGGGGGACTTTGG - Intergenic
904896277 1:33820677-33820699 CCTGCTTTGTTGGGGCTGTGTGG + Intronic
904987623 1:34564975-34564997 CCTGCCTTCTTTGGGGTGGTAGG - Intergenic
905937874 1:41839230-41839252 GCTGCTTTGGATGGGGAGGTGGG - Intronic
908483805 1:64570544-64570566 CCTGCTTTCTATTGGCTGTTTGG - Intronic
911715966 1:101133449-101133471 TCTGGTTTATATGGGGTTTTTGG + Intergenic
916709991 1:167396265-167396287 CCTGCTCTGTATTGTGTGTAGGG + Exonic
919930501 1:202218252-202218274 CCTGCTATTCAGGGGGTGTTTGG + Intronic
920310721 1:205046799-205046821 CCTGCTCTGTGTGTGGTGTGAGG - Intronic
921609183 1:217190730-217190752 TCTGCTTTTTAAGGGGTTTTAGG + Intergenic
922712709 1:227845414-227845436 CCTGCTTCGTGTGGGGTGGGGGG - Intronic
923627452 1:235625576-235625598 CCTGCTCTGAATGTGGCGTTGGG - Intronic
1064251310 10:13708359-13708381 CCAGTTTTATATGGGGTGCTAGG - Intronic
1068628325 10:59273248-59273270 CATCCTTTGTATAGGGTATTTGG + Intronic
1069518683 10:69100668-69100690 CCTGCTCTGTATTGGCTGTGGGG + Intronic
1070521300 10:77255938-77255960 CCTTCTTTGCATCAGGTGTTAGG - Intronic
1073918961 10:108437245-108437267 CAGGCTTTGTAGGAGGTGTTAGG - Intergenic
1074153265 10:110777439-110777461 TCTTCTTTGTCTAGGGTGTTTGG + Intronic
1074435707 10:113432428-113432450 CCTGCATGAGATGGGGTGTTTGG - Intergenic
1075227715 10:120644725-120644747 ACTGCATTGTATGTGGTGCTTGG - Intergenic
1084932513 11:72568584-72568606 CCTGATTTGTCTGTGTTGTTTGG + Intergenic
1086905151 11:92410126-92410148 CCTGCTATGTGTGTGGTGGTTGG + Intronic
1088534325 11:110843472-110843494 CCTTTTTTGTATTGGGTTTTTGG + Intergenic
1088630535 11:111769987-111770009 GCTCCATTTTATGGGGTGTTAGG - Intergenic
1089627436 11:119760633-119760655 CCTGCTGTGCATGGGGTATTGGG - Intergenic
1093941036 12:25054737-25054759 CCTGATTTGTATGGGTTTTTTGG - Intronic
1094692082 12:32779453-32779475 CCTGATGTGTATGTGGTGTGTGG - Intergenic
1097041572 12:56158969-56158991 CCTGCTGTGTGTGGGGTCTCGGG + Intronic
1098343473 12:69475374-69475396 TGTGCTTTGTCTGGGCTGTTTGG + Intronic
1101230431 12:102735476-102735498 CCTGGTTTGTCTGGGTTGTGAGG + Intergenic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1107847390 13:44530609-44530631 CCAGCTTTTTATCGGGTGTTTGG - Intronic
1108335744 13:49440274-49440296 CCAGTTTTGTATGTGGTGTAAGG + Intronic
1109766958 13:66913498-66913520 CCGGCTATGTAGGGGGTGTTGGG + Intronic
1113251521 13:108458366-108458388 CCTGCTTTGGATAGGTTGGTTGG - Intergenic
1117936680 14:60914468-60914490 CCAGCTTTGAATGGTGTGTCTGG + Intronic
1119225844 14:72943927-72943949 CCTTCCATGTAAGGGGTGTTGGG + Intronic
1122337390 14:101002799-101002821 CCTTCTTAGTTTGGGGTATTGGG + Intergenic
1122373619 14:101243339-101243361 CCTTCTTTTTTTGGGGGGTTGGG + Intergenic
1128417081 15:67456870-67456892 ACTGCCTTCTATGGGGTGTTTGG - Intronic
1130065248 15:80597432-80597454 GCTCCTTAGTATGGGGTGTTTGG - Exonic
1132354190 15:101159252-101159274 CATGCTTTGTGGGGGGTGTAGGG - Intergenic
1132959195 16:2612758-2612780 CCTGCTCCGAATGGGGTGTGGGG + Intergenic
1132972255 16:2694733-2694755 CCTGCTCCGAATGGGGTGTGGGG + Intronic
1133897380 16:9942671-9942693 GCTGGTTTGCATGGGGTGGTGGG - Intronic
1134095364 16:11415175-11415197 CCTGTTCTGTAGGGGGTGATGGG - Intronic
1134473228 16:14547273-14547295 CCTGCTGGCTTTGGGGTGTTTGG - Intronic
1134924895 16:18150782-18150804 CCTGCTGTGTGGGGCGTGTTGGG - Intergenic
1136123378 16:28156982-28157004 CCAACTTTGTATGTGGTGTTAGG - Intronic
1140227799 16:73092772-73092794 CCTGCTATTTATGGGTTGCTTGG + Intergenic
1141323794 16:83036852-83036874 CCTGGCTTGTGTGGGGTGTATGG - Intronic
1142308575 16:89299372-89299394 CCTGCCCTGTGTGGGGTGTGTGG + Intronic
1142308600 16:89299462-89299484 CCTGCCCTGTGTGGGGTGTGTGG + Intronic
1142308711 16:89299849-89299871 CCTGCCCTGTGTGGGGTGTGTGG + Intronic
1142308743 16:89299966-89299988 CCTGCCCTGTGTGGGGTGTGTGG + Intronic
1142308808 16:89300191-89300213 CCTGCCCTGTGTGGGGTGTGTGG + Intronic
1142310680 16:89311444-89311466 CATGTTTTGTATGTGGTGTGAGG - Intronic
1142310686 16:89311518-89311540 CATGTTTTGTATGTGGTGTGAGG - Intronic
1143733726 17:8895978-8896000 CCTGCTTAGCATGGGGTGTGGGG + Intronic
1143777263 17:9207747-9207769 CCTGCTGTCTATGGGGTGTGGGG - Intronic
1144312829 17:14028587-14028609 CCTGCTTCCTTTGGGTTGTTTGG - Intergenic
1144331927 17:14232740-14232762 CCTGCTTCCTTTGGGTTGTTTGG + Intergenic
1146553736 17:33805024-33805046 ACTGCTTTTTATGGGGCGTCTGG - Intronic
1146755552 17:35429164-35429186 CCTTCTGTGTATGGTGGGTTAGG - Intronic
1146884769 17:36463761-36463783 CCTGCTACCTATGGGGTGGTGGG - Intergenic
1149379829 17:56082163-56082185 GCTGATTTGTATGGGGAGCTTGG - Intergenic
1150650669 17:67008103-67008125 CCTGCTGTGTGTGAGGTGCTGGG - Intronic
1150747849 17:67830748-67830770 GCTCCTTTGTATGCTGTGTTGGG + Intronic
1152117420 17:78397150-78397172 CCAGGTTTATATGAGGTGTTGGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1157202927 18:45674661-45674683 CCTACTTTGTGGTGGGTGTTAGG - Intronic
1157713646 18:49867133-49867155 CCTGGTTTGCATGGGGAGATGGG + Intronic
1159652310 18:70992045-70992067 CCTGAGTTGTATGTGGTGTGTGG - Intergenic
1163197800 19:15736141-15736163 CCTCCTTTGTATGTAGAGTTTGG + Intergenic
1163224101 19:15943271-15943293 CCTCCTTTGTATGTGCTGTTAGG + Intergenic
1164707118 19:30328016-30328038 CCTGCTTTGTAAGGTGGGTGTGG + Intronic
1165092137 19:33393073-33393095 CCTGCTCTGTGTGGGGGGTGGGG - Intronic
925555947 2:5131899-5131921 GCTGCTTTCTATTCGGTGTTAGG - Intergenic
926116824 2:10218534-10218556 CCTGCTCTGTGTTGGGTGCTGGG + Intergenic
927985093 2:27404566-27404588 ACTGCTTTCTATGGAGAGTTAGG - Intronic
937289999 2:120776416-120776438 CCTGCTTGCTCTGGCGTGTTTGG + Intronic
937744878 2:125400431-125400453 CCTGCTTTGTATTAGGTTTTGGG - Intergenic
938305110 2:130248004-130248026 GCTGCCTTCTATGGGGTGTCGGG + Intergenic
939037385 2:137149170-137149192 CTTGGTGTGTATGTGGTGTTGGG + Intronic
939737390 2:145865550-145865572 CCTGGTTTGTATTTGGAGTTTGG + Intergenic
947633729 2:231669654-231669676 CCAGCTTTGTATGAGGTGGTGGG - Intergenic
948728001 2:239946410-239946432 CATGCTCTGTATGAGGTGCTGGG + Intronic
1169699636 20:8432015-8432037 TCTTCTTTGTATGTGGTGGTGGG + Intronic
1170446341 20:16431785-16431807 GCTATTTTGTATGGGGTGATGGG - Intronic
1174302138 20:49590057-49590079 CCTCCTTTGGCTGGGGTGGTCGG - Intergenic
1177080630 21:16634611-16634633 CCTGTTTTGGAGGTGGTGTTTGG + Intergenic
1178069586 21:28948733-28948755 CCTCCATAGTATGGAGTGTTAGG - Intronic
1181336241 22:22132154-22132176 CCTGGTATGTATGTGGAGTTGGG + Intergenic
1182681196 22:32081290-32081312 CCTGCTATGTAAGAGGTGCTTGG + Intronic
1184412752 22:44334301-44334323 TGTGATTTGTATGTGGTGTTTGG + Intergenic
950571459 3:13802863-13802885 CCCTCTCTGTATGGGGTGCTGGG + Intergenic
952316410 3:32236584-32236606 TCTGCTTTGCATGGTGTGATTGG - Intergenic
952331408 3:32367399-32367421 CCTGTTTGGAATGGGGGGTTAGG + Intronic
952492720 3:33887497-33887519 GCTGCTTTGTGTGGAGTCTTGGG + Intergenic
953441195 3:42918940-42918962 CCTGCTAAGATTGGGGTGTTTGG + Intronic
953766963 3:45750343-45750365 CCTTCTTTGGAAGGAGTGTTGGG + Intergenic
964504536 3:157384313-157384335 CCTGCTTGATATAGGGTGGTAGG + Intronic
966239061 3:177734835-177734857 ACTGCTGAATATGGGGTGTTGGG + Intergenic
966678757 3:182618233-182618255 CATGTTTTGTTTGGGGTGCTGGG - Intergenic
967316430 3:188154941-188154963 CCTGCACTGAATGGGGTTTTTGG + Intronic
967985770 3:195094502-195094524 CCAGCTTTGTACAGGGTGTGGGG - Intronic
973614375 4:52663995-52664017 CCTTCCTTGTATGATGTGTTTGG + Intergenic
974400540 4:61399795-61399817 CCTGCTTTCTTTGGGATTTTAGG + Intronic
975397809 4:73897527-73897549 CTTGGTTTGTATGGGGTGTAAGG + Intergenic
975922551 4:79409492-79409514 CCTCATTTGTCAGGGGTGTTGGG - Intergenic
984943177 4:184951899-184951921 CCTGGTGTGTATGGGGTGGGGGG + Intergenic
985039047 4:185870401-185870423 CCTCCTTTGTCTGGGTAGTTGGG - Intronic
987234099 5:15926127-15926149 CCAGCTTACTATGGGGTTTTCGG - Intronic
989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG + Intergenic
992498446 5:77317467-77317489 CCAGCTCTGTGTGGGGTGTGTGG - Intronic
994346368 5:98692118-98692140 CCAGCTTTGTTTGGGGGTTTTGG + Intergenic
996638970 5:125730044-125730066 CCTCCTTTGGCTGGGGTGTGGGG - Intergenic
998765011 5:145476770-145476792 TCTCCTTTTTATGTGGTGTTGGG + Intronic
999128184 5:149262294-149262316 CAGGCTTTGTAGAGGGTGTTTGG + Intergenic
999474916 5:151889728-151889750 TATGGTTTGTATGGGGTTTTAGG + Intronic
999857679 5:155612934-155612956 CCTGCCATGTATTAGGTGTTTGG + Intergenic
999898010 5:156055433-156055455 CCTGCTTTCAGTGGGGTGTCTGG - Intronic
1001118956 5:168962934-168962956 CTTGCTTTGGATGGAGTGATGGG - Intronic
1001922125 5:175609085-175609107 CCTGCTCTGTGTGGGGTGAACGG + Intergenic
1005704020 6:28433430-28433452 CTTGCTATGTATTGGGTATTTGG + Exonic
1005838778 6:29726248-29726270 CCTGATGTGAGTGGGGTGTTGGG + Intronic
1010050349 6:71496862-71496884 TCTGCTGTGCATCGGGTGTTGGG - Intergenic
1010520097 6:76822192-76822214 CCTGTTTAATATGTGGTGTTGGG - Intergenic
1018756953 6:166858153-166858175 TCTGCTTTGTTTGGGGAGATTGG - Exonic
1019765228 7:2844642-2844664 CGGGCTTTGGATTGGGTGTTCGG + Intergenic
1021565248 7:22010331-22010353 CTTGCCTTGTAGGGAGTGTTTGG + Intergenic
1023338425 7:39194185-39194207 CCTGGTCTGTTTGGAGTGTTTGG - Intronic
1028584771 7:92442173-92442195 CATGCTGTGTATGGATTGTTGGG - Intergenic
1033426976 7:141253345-141253367 CCTCCTTTCTCCGGGGTGTTTGG + Intronic
1034964917 7:155384888-155384910 CCTGCTCTGTCTACGGTGTTTGG + Intronic
1036692977 8:10956404-10956426 CCTGCTTTGTATGGGGTGTTGGG - Intronic
1042510995 8:69610790-69610812 CCTGATTAGGATGGGCTGTTAGG - Intronic
1042829826 8:73014808-73014830 TCTGCTTTGTTTGGGGGGTGAGG + Intronic
1042978530 8:74499455-74499477 CCTGCTTAGAAAGGAGTGTTTGG + Intergenic
1043799329 8:84588005-84588027 CCTCCTATGTGTGGGGTGTGTGG - Intronic
1044832913 8:96267792-96267814 CCTGCTGGGTGTTGGGTGTTGGG - Intronic
1045017550 8:98012203-98012225 CCTGCATTGTGCGGGGTGCTGGG + Intronic
1049230474 8:141478970-141478992 CATGGTTTGGGTGGGGTGTTAGG + Intergenic
1049270176 8:141691414-141691436 CCTGGTGTGGATGGGGTGTCAGG - Intergenic
1049470682 8:142773910-142773932 CCTGCTGTGAATGGGGCATTCGG - Intronic
1051341505 9:16116173-16116195 CTATCTTTGAATGGGGTGTTTGG - Intergenic
1051952622 9:22654930-22654952 AGAGCTTTGTATGAGGTGTTAGG + Intergenic
1053419365 9:37967587-37967609 CATGCTTTGTATTAGGTGTGGGG - Intronic
1053441141 9:38117461-38117483 CTTGCTCTGTTTGGGGTTTTGGG - Intergenic
1055191614 9:73531192-73531214 CCTGTTTTTTATGTGTTGTTAGG + Intergenic
1058881483 9:109289271-109289293 CCTGCTGTGTATGGTGGGGTGGG - Intronic
1060494434 9:124107659-124107681 CCTGATTGGTATGGGGGGTGGGG + Intergenic
1061406310 9:130394680-130394702 CCTCCTCTGTGTGGGGTGTGAGG + Intronic
1062543773 9:137052935-137052957 CCTGCCTTGTTGGGGGTGCTGGG + Intronic
1186434199 X:9529040-9529062 CCTGCTTTGTTTGGGTTTTTTGG + Intronic
1188031155 X:25265823-25265845 TCTGCATCTTATGGGGTGTTAGG + Intergenic
1189832598 X:44989650-44989672 CATGCTTTGTTTGAGGGGTTTGG + Intronic
1192138705 X:68630219-68630241 CCTGTTGTGTGTGGGGTGTGGGG - Intergenic
1192147078 X:68689074-68689096 CCTGTTGTGTGTGGGGTGTGGGG + Intronic
1194058284 X:89164195-89164217 CCTCCTTTGGCTGGGGTGGTGGG + Intergenic
1197461655 X:126750142-126750164 ACTGCTCTGTATGAGGGGTTTGG - Intergenic
1198526806 X:137509464-137509486 CCAGTTCTGTATGGGCTGTTGGG - Intergenic
1202110474 Y:21411624-21411646 GATGCTTTTTTTGGGGTGTTAGG - Intergenic