ID: 1036694963

View in Genome Browser
Species Human (GRCh38)
Location 8:10968232-10968254
Sequence TGGGGGCAGCTGACGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 459}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036694963_1036694971 18 Left 1036694963 8:10968232-10968254 CCGTCCTCCGTCAGCTGCCCCCA 0: 1
1: 0
2: 2
3: 49
4: 459
Right 1036694971 8:10968273-10968295 AGAAAAGTGCCTCTGCAGATTGG No data
1036694963_1036694972 24 Left 1036694963 8:10968232-10968254 CCGTCCTCCGTCAGCTGCCCCCA 0: 1
1: 0
2: 2
3: 49
4: 459
Right 1036694972 8:10968279-10968301 GTGCCTCTGCAGATTGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036694963 Original CRISPR TGGGGGCAGCTGACGGAGGA CGG (reversed) Intronic
900425764 1:2577940-2577962 TCGGGGCATCTGAGGGAGGACGG - Intergenic
900534440 1:3170106-3170128 TGAGGGCAGCTGAGCGCGGACGG + Intronic
901026072 1:6279353-6279375 TGGGGGCAGATGAGGGAGGAAGG + Intronic
901105982 1:6756913-6756935 TTTGGGCAGCTGAGGCAGGAAGG + Intergenic
901236131 1:7668560-7668582 TGGTGGGAGATGACGCAGGAGGG - Intronic
901397168 1:8989863-8989885 TAGAGGCAGCTGACTGAGGGAGG + Intergenic
901757601 1:11450848-11450870 TGGGGGCAGGTGAGGGTGGCAGG - Intergenic
902410126 1:16207479-16207501 TGGGAGGAGGTAACGGAGGAAGG - Intronic
903054997 1:20629722-20629744 TTTGGGAAGCTGAGGGAGGAAGG + Intergenic
903137591 1:21319525-21319547 TGGGGGCAGCAGAGGGAGTCTGG - Intronic
903192336 1:21663728-21663750 TGGGGGCAGCAGAGGGAAGGTGG - Intronic
903213937 1:21832954-21832976 TGGAGGCAGAGGAGGGAGGAAGG + Intronic
903346189 1:22685702-22685724 CGGGGGCTGCTGTGGGAGGATGG - Intergenic
903462713 1:23530687-23530709 TGGGGGCTGCTGAGGCCGGATGG + Exonic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
904085152 1:27901247-27901269 TGATGGCTGCTGACTGAGGAGGG - Intronic
904131802 1:28281050-28281072 TGTGGGCAGGGGAAGGAGGAAGG - Exonic
904473052 1:30747682-30747704 TGGGGGCAGGGGCTGGAGGATGG + Intronic
905199861 1:36308046-36308068 TGGGGGCTGCTGATGGATGGGGG + Intronic
905915504 1:41681726-41681748 TGGTGGCACCTGAGGGAGGAGGG + Intronic
905958066 1:42015859-42015881 TGTAGGCAGCTGAAGGATGATGG - Intronic
905962817 1:42059402-42059424 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
906653712 1:47533150-47533172 TGGGGGAAGAAGAGGGAGGATGG - Intergenic
907090383 1:51718958-51718980 TGGGGGCTGCTGAAGGGTGATGG - Intronic
907238942 1:53070042-53070064 CGGGGGCAGCTGACCGCGGCTGG - Exonic
907462704 1:54614784-54614806 CTGCGGCAGCTGACAGAGGAAGG - Exonic
908532680 1:65048850-65048872 TGGGAGCAGCTGTACGAGGAAGG + Intergenic
908769761 1:67585254-67585276 TGGAGGAAGCTGACTGAGCACGG + Intergenic
910931481 1:92446748-92446770 TGGTGGCTGCTGAGGGAGGAGGG - Intergenic
912742303 1:112211795-112211817 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
913369505 1:118082828-118082850 TGGGGGAAAGTGACTGAGGAAGG + Intronic
915040683 1:152965946-152965968 GGGAGGGAGCTGAGGGAGGAGGG - Intergenic
915734929 1:158078606-158078628 AGGAGGCAGCTGAGGGAAGAAGG - Intronic
916169290 1:161988586-161988608 TGGTGGAAGCTGGGGGAGGAAGG - Intronic
916787538 1:168097291-168097313 TGGGAGCCCCTGACGCAGGAAGG - Intronic
917029329 1:170671777-170671799 TGGGGCCAGATGACCGTGGATGG + Intronic
919840883 1:201608717-201608739 TGGGGTCAGCTGGGGGAGGAGGG + Intergenic
919939820 1:202278547-202278569 TGGAGGCAGGTGAGGGATGAAGG - Intronic
920373814 1:205495660-205495682 TGGAGCCAGCTGACAGAGGCAGG + Intergenic
920648377 1:207819396-207819418 TGGGGGCTGGTGACGGCAGAGGG - Intergenic
922539435 1:226407926-226407948 TGGCGGCAGCTAGGGGAGGATGG - Exonic
922707129 1:227795598-227795620 TGGGGGCAGCTCCCGTGGGAAGG - Intergenic
923372568 1:233328007-233328029 TGGGGGCAGCTGCGCGGGGAAGG - Exonic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
1062940958 10:1421121-1421143 TGGGGGCACCGGCTGGAGGAGGG + Intronic
1062950860 10:1502205-1502227 TGGGGGCAGCAGGTGCAGGAGGG - Intronic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1064122817 10:12634409-12634431 TGGGGGCAGAGGCAGGAGGATGG - Intronic
1064901432 10:20299785-20299807 TGGGGCCTGTTGAAGGAGGATGG - Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066149366 10:32598472-32598494 TGGGTGCAGCCCACGGAGCAGGG - Intronic
1066200954 10:33142330-33142352 AGGGAGCTGCTGATGGAGGAGGG + Intergenic
1068945466 10:62724704-62724726 TGGGGGCAGCTGATGAGGGAGGG + Intergenic
1069734601 10:70645471-70645493 TGGGTGCAGCTCATGGAGGGTGG - Intergenic
1069798898 10:71070232-71070254 TGGGGGCAGTCGGAGGAGGAAGG + Intergenic
1069806323 10:71127232-71127254 TGGGGGCAGCTGCTCCAGGAAGG + Intergenic
1071597004 10:86935604-86935626 AGGAGGCAGCTGAGGGAGGAGGG - Exonic
1072731485 10:97849944-97849966 TGGGGGCGGCCGGGGGAGGAGGG - Intergenic
1072741139 10:97910690-97910712 TGGGGGCATCTCTCAGAGGATGG - Intronic
1073022189 10:100454617-100454639 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
1073425930 10:103455471-103455493 TGGGGGCAGCTGCGGAAGCAGGG + Exonic
1073485995 10:103819559-103819581 TGGGGGCAGAAGAGGGAGGAGGG + Intronic
1073563451 10:104516335-104516357 GGGAGGCAGCTGTTGGAGGAGGG - Intergenic
1074853491 10:117456969-117456991 TGGGAGCAGCTCCCGGAGCAGGG + Intergenic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1074998699 10:118779418-118779440 TGGGGGCAGCTTCCAGAGGCTGG + Intergenic
1075530336 10:123223673-123223695 AGGGTGCAGCTGAGAGAGGAAGG - Intergenic
1075719514 10:124576597-124576619 TGGGGGCAGACCATGGAGGAGGG - Intronic
1075857188 10:125639610-125639632 TGGGGGAAGCTGAGGGTGGGAGG + Intronic
1076211942 10:128655843-128655865 TGGGGACAACAGACAGAGGAGGG + Intergenic
1076785737 10:132749024-132749046 TGGGTGAAGCTGACGTGGGAGGG - Intronic
1076916383 10:133424708-133424730 AGGGGGCTGGTGACGGAGGACGG - Intergenic
1076936490 10:133569503-133569525 AGGGGGCTGGTGACGGAGGACGG - Intronic
1076996592 11:300041-300063 GGAGGGCGGCTGTCGGAGGAGGG + Intergenic
1077147411 11:1052348-1052370 TGGGGGCAGGTGCCCCAGGAGGG - Intergenic
1077408023 11:2391323-2391345 TGGGGGCACCTGCCGGCTGAGGG - Intronic
1077694953 11:4385501-4385523 TGGAGGCACCTGAAGGTGGAGGG + Exonic
1078436556 11:11330400-11330422 TGGGGGCAACTGGCTGAAGATGG - Intronic
1079094785 11:17503177-17503199 TGTGGGCAGCAGACAGAGGAGGG + Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080496956 11:32829922-32829944 GGGAGGCGGCCGACGGAGGACGG - Exonic
1080582639 11:33656713-33656735 TGGGGGAAGCTGGAGTAGGAAGG - Intronic
1080847772 11:36041380-36041402 TGGGGGTCTCTGATGGAGGAAGG - Intronic
1081564526 11:44249498-44249520 TGGGAGTGGCTGACAGAGGAGGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1082180054 11:49106403-49106425 TGGGGGCAGCTGGGGCAAGATGG - Intergenic
1082834113 11:57639542-57639564 TGGGGGCAGGGGCCGGAAGATGG + Intergenic
1083509913 11:63199557-63199579 TGAGGGCAGCTAAGTGAGGAGGG - Intronic
1083616416 11:64028687-64028709 TGGGAGGAGCTGCGGGAGGAGGG - Intronic
1083840512 11:65301704-65301726 TGGGGGCAGGGGAGGGAAGAGGG + Intronic
1083895775 11:65619031-65619053 CGGGGGGAGCTGCAGGAGGAAGG + Exonic
1083942350 11:65903190-65903212 CTGGGGCAGCTGAGGGAGCAGGG + Intergenic
1083997020 11:66277823-66277845 TGGGGGGCGCTGAAGGAGGTTGG - Intergenic
1086347035 11:85907590-85907612 GGGGGGCAGCTGAGGCAGGGAGG + Intronic
1088875497 11:113932831-113932853 TGGGGGCAGGAGAACGAGGAAGG + Intronic
1089970252 11:122687522-122687544 GGGGGGCAGATGAGTGAGGAGGG + Intronic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1090977243 11:131688518-131688540 TGGGAGCAGCAGGCGGAGGGAGG - Intronic
1091310761 11:134573700-134573722 TGGGGGCAGAGGAGGCAGGAAGG + Intergenic
1091426850 12:398030-398052 TGGGGGCTGCTGACTGATCATGG + Intronic
1091473718 12:752804-752826 TGCCGGGGGCTGACGGAGGAGGG - Intronic
1091653395 12:2326038-2326060 TGGGGGCAGCAGGGGGAGGCAGG + Intronic
1091719026 12:2799030-2799052 AGAGGGCAGGTGACTGAGGAAGG - Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092902416 12:13072153-13072175 GGGGGGAACCTGACGGAGGCAGG + Intronic
1095306364 12:40643173-40643195 TGGGTGCAGCCCACGGAGAAGGG - Intergenic
1095551724 12:43449472-43449494 TGGGGCCTGCTGAGGGTGGAGGG + Intronic
1095977752 12:47951398-47951420 TGGAGGCAGGTGTGGGAGGAAGG - Intergenic
1096079498 12:48824234-48824256 TGGGGGCAGGTGGAGCAGGAAGG - Intronic
1096431998 12:51552935-51552957 TGAGGGCTGCTGACTGATGAGGG + Intergenic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096619021 12:52850886-52850908 TGGGGCCAGGGGAAGGAGGAAGG - Intergenic
1096623634 12:52879792-52879814 TGGGGGGAGCTGAGGGCGGAGGG - Intergenic
1096668669 12:53184490-53184512 TGAGGGCTGTTGAGGGAGGAAGG + Intronic
1097774945 12:63634455-63634477 TGGGTGCAGCCCACGGAGCAGGG + Intronic
1100430791 12:94530286-94530308 TGGGGTCAGCTGGAAGAGGAAGG - Intergenic
1100750907 12:97697290-97697312 TGGGTGCAGCCCACGGAGCAGGG - Intergenic
1101789279 12:107912770-107912792 AGGGGGCAGCTGCCGGTGGAGGG + Intergenic
1102244171 12:111344607-111344629 TGGAGGGAGCTGAGGGAGGTGGG + Intronic
1102263104 12:111457270-111457292 TGGGGGTAGCTGAAGGCTGAGGG + Exonic
1102349361 12:112180771-112180793 TGGGGGCAGCTGAGAGCTGAGGG + Intronic
1102926180 12:116828172-116828194 TGAGGGCAGGTAAGGGAGGAAGG - Intronic
1103000957 12:117384956-117384978 TGGGGGCTGCTGACTGCAGATGG - Intronic
1104095295 12:125551755-125551777 TGGGGGCAGTTGAGCCAGGAGGG + Intronic
1104418990 12:128619652-128619674 TGGGGACAGCGCAGGGAGGAGGG - Intronic
1104523315 12:129495622-129495644 TGGGAGCAGCTCAGGGAGAAAGG - Intronic
1105250846 13:18697717-18697739 TGGGGGCAGCTGTCCCAGGGTGG - Intergenic
1105760755 13:23512264-23512286 TGGTGGCAGGTGAGGGGGGACGG - Intergenic
1106404638 13:29463124-29463146 TTGGTGCATCTGATGGAGGAAGG + Intronic
1106619182 13:31357070-31357092 TGGGGGCAGCTGGGGGAGTAGGG + Intergenic
1107406415 13:40118161-40118183 TGTGGGAAGCTGAGGCAGGAGGG + Intergenic
1107961602 13:45564069-45564091 TGGGGGCAGCTGACAGAGCAGGG + Intronic
1108500805 13:51068157-51068179 TAGGGGCAGCTGAGGGTGGTAGG - Intergenic
1110510243 13:76342445-76342467 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
1113520437 13:110936740-110936762 TGGCGGCAACTGTGGGAGGATGG + Intergenic
1113666142 13:112143223-112143245 TGGGTGCAGATGAGTGAGGAGGG - Intergenic
1114399634 14:22397557-22397579 TGGGGGCCACTTACAGAGGAAGG - Intergenic
1114724446 14:24920678-24920700 TGGGGGCAGCTGAGGGAGACAGG - Intronic
1115505151 14:34086670-34086692 AGGTGGCAGGAGACGGAGGAGGG + Intronic
1115779750 14:36756206-36756228 CGGGGGCAGCTGAGGGAAGGTGG + Intronic
1116928904 14:50670305-50670327 AGGCGGGAGCTGAAGGAGGAAGG + Intergenic
1118134007 14:63001534-63001556 TGTTGGCAGCTGAAGGAAGAAGG - Intronic
1118596216 14:67437568-67437590 TGCGGGCAGCCGTGGGAGGAAGG + Intergenic
1119705827 14:76781998-76782020 TGGGGGCTGCTGGCTGAGGAGGG + Exonic
1119736309 14:76984942-76984964 AGGAGGAAGCTGATGGAGGAGGG - Intergenic
1121255568 14:92528030-92528052 TGGGGGCAGCTCAGGGAGGGGGG + Intronic
1122183417 14:99971747-99971769 TGGGGGCCGCCGCCGGGGGATGG - Intronic
1122255498 14:100472884-100472906 TGTGGGCATCTGAAGGAAGAGGG - Intronic
1122438179 14:101712919-101712941 TGGGGGGAGATGACGGTGGGTGG - Intergenic
1122438218 14:101713067-101713089 TGGGGGGAGATGACGGTGGGTGG - Intergenic
1122438226 14:101713087-101713109 TGGGGGGAGATGACGGTGGGTGG - Intergenic
1122438316 14:101713435-101713457 TGGGGGGAGATGACGGTGGGTGG - Intergenic
1122438324 14:101713455-101713477 TGGGGGGAGATGACGGTGGGTGG - Intergenic
1122456831 14:101860196-101860218 TGGGGGTGGGTGAGGGAGGAGGG - Intronic
1122811663 14:104292298-104292320 GTGGGGCAGCTGAGAGAGGAAGG + Intergenic
1122837217 14:104436190-104436212 TGGGCGGAGCTGAGGGAGGCAGG + Intergenic
1124113627 15:26817922-26817944 TGGTGACAGGTGTCGGAGGAAGG - Intronic
1124382333 15:29177173-29177195 TGGGAGCGGCTGGGGGAGGATGG + Intronic
1124512712 15:30340490-30340512 TGACGCCACCTGACGGAGGAGGG + Intergenic
1124730203 15:32190260-32190282 TGACGCCACCTGACGGAGGAGGG - Intergenic
1126158478 15:45587153-45587175 TGGTGGGAGCTGGGGGAGGACGG - Exonic
1126697912 15:51341461-51341483 TGGAGGCAGCCTGCGGAGGAGGG - Intergenic
1128378261 15:67092624-67092646 TGGGGGCAGGATACTGAGGAGGG + Intronic
1128862586 15:71086428-71086450 TGGGGGCTGCAGACACAGGAAGG - Intergenic
1129174892 15:73832777-73832799 TGGGGGCAGGTGAGGTAGGTGGG - Intergenic
1129776623 15:78241198-78241220 TGGGGGCAGGGGAGGAAGGACGG - Intronic
1130223844 15:82043797-82043819 TCGGGGCAGCCGTCGGGGGATGG + Exonic
1130992073 15:88881566-88881588 TGGTGGAAGCTGTCGGAGAACGG - Exonic
1131233775 15:90679195-90679217 TTGGGGCAGCTGAACAAGGAAGG - Intergenic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1131853928 15:96571852-96571874 AGGGGTCAGCTGATGTAGGATGG - Intergenic
1132186684 15:99806952-99806974 CGGGGCCAGCTGAGGGAGGAAGG - Intergenic
1132354912 15:101164094-101164116 TAGGGGCAGTTTAGGGAGGATGG - Intergenic
1132429003 15:101745759-101745781 CGGGGCCAGCTGAGGGAGGAAGG + Intergenic
1132537641 16:490942-490964 TGGAGGCAGCTGAGGGATGTGGG + Intronic
1132579910 16:680045-680067 TGGGGCCGGCTGCCGGGGGAGGG + Intronic
1132605003 16:789970-789992 TGGGGGCAGCTTTAGGAGAAAGG - Intronic
1132740818 16:1412110-1412132 TGTGGGCTGCTGGCGGAGGGTGG - Intronic
1132744316 16:1430395-1430417 TGGCTGCAGCTGAGGAAGGAAGG + Intergenic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133152925 16:3850435-3850457 TTGGGGCTGCTGGCAGAGGAAGG - Exonic
1133346966 16:5077671-5077693 TTGGGGAAGCTGGGGGAGGAGGG + Intronic
1133997926 16:10762124-10762146 TGGTGGCAGGGGACTGAGGAGGG + Intronic
1134364196 16:13561623-13561645 TGTGGGGAGCTGAGGGTGGAAGG + Intergenic
1136112741 16:28075059-28075081 TGGAGGGAGCTGACCTAGGAAGG + Intergenic
1136237809 16:28925276-28925298 TGGAGGCCCCGGACGGAGGATGG + Exonic
1136622110 16:31436217-31436239 TGGGGGCAGATGTTGAAGGAAGG + Exonic
1138599408 16:58046054-58046076 TGGGGGCTGCTGCCGGGGGTGGG - Exonic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1140782318 16:78307982-78308004 ATGTGGCAGCTGATGGAGGAAGG + Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1141338307 16:83178282-83178304 TTGTCGCAGCTGGCGGAGGAGGG - Intronic
1141492070 16:84380502-84380524 TGGGGGAGGCGGAGGGAGGAAGG + Intronic
1141511404 16:84514486-84514508 TGGGGACACCTGAAGGATGAGGG - Intronic
1142223460 16:88866247-88866269 TGGCTGCAGCTGACTTAGGAGGG - Intronic
1142601894 17:1057168-1057190 TGGGGGCTGCTGCAGGAAGACGG + Intronic
1142852368 17:2710509-2710531 TGAGGACAGTCGACGGAGGAGGG + Intronic
1143361748 17:6376894-6376916 TGGGAGAAGCTTCCGGAGGAAGG + Intergenic
1143544656 17:7589060-7589082 TGGGGGCGGATGCCGGAGGACGG - Intronic
1143863698 17:9908979-9909001 TGGGGACAGCTGTGGGAGGAGGG - Intergenic
1144581739 17:16463113-16463135 AGGAGGCAGCTGACACAGGAAGG + Intronic
1145241493 17:21243141-21243163 TGGAGGCAGCTGACCAATGATGG - Exonic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147161603 17:38572257-38572279 TGGGGGCAGGCGCCCGAGGAGGG - Intronic
1147178486 17:38671188-38671210 TGGGGGCAGGTGATGCAGGGAGG + Intergenic
1147742968 17:42679194-42679216 TGAGGCCAGGTGACGGTGGAGGG + Exonic
1147856488 17:43484224-43484246 TGAGGGAAGCGGAAGGAGGAAGG + Intronic
1148115572 17:45172777-45172799 TGGGGGCAGCTACCGGAAGTAGG - Intergenic
1148324714 17:46776630-46776652 TGGGGGCAGCTGGCACAGCAGGG - Intronic
1148780247 17:50117448-50117470 CTGGGGGAGCTGTCGGAGGAGGG + Exonic
1148852060 17:50560304-50560326 TTTGGGCAGCAGCCGGAGGACGG - Intergenic
1148930102 17:51120797-51120819 TGGGGGCCGGGGCCGGAGGAGGG + Exonic
1148958918 17:51376761-51376783 GGGGGGCAGTTAAGGGAGGAGGG + Intergenic
1149721806 17:58852247-58852269 TGGGTGCAGCCCACGGAGCAGGG - Intronic
1150505127 17:65691010-65691032 TGGTAGCAGCTGATGAAGGAAGG + Intronic
1151171937 17:72253971-72253993 TGGGGGAATCTGAAGGAGGGAGG + Intergenic
1151516409 17:74599014-74599036 AGGGAGCAGGTGACAGAGGAGGG + Intergenic
1151565945 17:74898339-74898361 TGGGGGCAGCTGGCAGGGGTAGG - Intergenic
1151825032 17:76519325-76519347 GAGGGGCAGCTGAGGGAGAAGGG - Intergenic
1152366220 17:79858049-79858071 TGAGGGCAGCTGGAGGTGGATGG + Intergenic
1152535474 17:80948314-80948336 AGGGGGCAGCGCTCGGAGGAGGG - Intronic
1152577260 17:81148319-81148341 TGGGGGCAGCAGAGAGTGGACGG - Intronic
1152761190 17:82107807-82107829 TGAGAGCAGCTGAGGCAGGAGGG - Intronic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1154470442 18:14695001-14695023 TGGGTGCAGTGGACTGAGGATGG - Intergenic
1155035406 18:22021194-22021216 TGGGGGCAACTGGAGCAGGAGGG + Intergenic
1157808803 18:50678683-50678705 TGGGGGCAGCTGTGGGACCAAGG - Intronic
1159332986 18:67025293-67025315 TGGGAGCAGCCAAGGGAGGAGGG + Intergenic
1159718184 18:71851118-71851140 TGGGTGAAGCTGACTGAGAAAGG - Intergenic
1159925874 18:74268636-74268658 TGGGGGCAGCTGCAGGTGCAAGG + Intronic
1161012554 19:1967678-1967700 TGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012677 19:1968030-1968052 TGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161175800 19:2841645-2841667 TGGGGGGAGCTGAGGGACGCGGG + Intronic
1161808011 19:6456278-6456300 TGGCAGCAGCTGACGGATGAGGG - Intronic
1161933691 19:7357821-7357843 TGGGGGCAGTTGATGGGGAAGGG - Intronic
1162495037 19:11018802-11018824 TTAGGGCAGCTGAGGGAGGGAGG - Intronic
1162531664 19:11239685-11239707 TGGGGGCCGCTGAGGCAGGCCGG - Exonic
1163237694 19:16038904-16038926 GGGCGGCAGCTGCCCGAGGAGGG - Intergenic
1163458203 19:17421023-17421045 AGGTGACATCTGACGGAGGACGG - Intronic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1164406285 19:27949674-27949696 TGGGTGCAGCTCACGGAGGGCGG - Intergenic
1164688686 19:30190610-30190632 TGGGTGCAGCCCACGGAGCAGGG - Intergenic
1165012538 19:32859348-32859370 TGGGGGCTGCTGAGGTGGGAGGG - Intronic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1166383977 19:42370223-42370245 TGGGTTCAGCTGTCGGAGGCGGG + Exonic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1168103890 19:54155339-54155361 TGGGGCCAGCGGAAGAAGGAAGG + Exonic
1168434416 19:56305964-56305986 TGGGGGCAGGAGAAGGGGGAGGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168645589 19:58057042-58057064 TGGGGGGTGCTGGCAGAGGAAGG - Intergenic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925189917 2:1874601-1874623 GGGGAGCAGGTGATGGAGGAAGG - Intronic
925778574 2:7358142-7358164 TGGTGGCAAGTGACTGAGGATGG - Intergenic
925788089 2:7452627-7452649 TGGGCGGTGCTGACGGTGGAGGG - Intergenic
926480518 2:13387354-13387376 AGGGGGCAGTTGACTGAGTAAGG - Intergenic
927064861 2:19461073-19461095 TGGGGGCAGTTGCAGGGGGAGGG - Intergenic
927268667 2:21182202-21182224 TGTGGCCAGCTGACTGAGGAAGG - Intergenic
928106208 2:28472041-28472063 TGGGGGCAGCTGCCTGGGGAGGG - Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG + Intronic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929687539 2:44047526-44047548 TGGGGGCAGAGGAGAGAGGATGG - Intergenic
929808421 2:45169045-45169067 TGGGCGCTGCGGACGGGGGACGG + Intergenic
929989945 2:46778438-46778460 GGGGGGCAGCAGAGGGAGGTGGG + Intergenic
930962362 2:57276805-57276827 TGGGTGCAGCCCACGGAGCAGGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932892805 2:75611299-75611321 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892833 2:75611394-75611416 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892856 2:75611475-75611497 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892883 2:75611570-75611592 TGGTGGGAGATGATGGAGGATGG - Intergenic
934163959 2:89277517-89277539 TGGGGGCGGGGGAGGGAGGAGGG + Intergenic
934203313 2:89905007-89905029 TGGGGGCGGGGGAGGGAGGAGGG - Intergenic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
935404943 2:102699112-102699134 TGGGGACTGCTGGGGGAGGAAGG + Intronic
936463072 2:112725824-112725846 TGGGGTCAGGTGCAGGAGGAAGG - Intronic
936629375 2:114184929-114184951 TGGGGGAAGCTGAGTGAGAAGGG + Intergenic
936663376 2:114567077-114567099 TGGAGCCAGCTGTTGGAGGATGG - Intronic
940158485 2:150684631-150684653 TTGGGGAAGCTGAGGGAGAATGG - Intergenic
940282778 2:152004623-152004645 AGTGGGCAGCTGATGCAGGAAGG + Intronic
941100136 2:161286329-161286351 TGGGTGCAGCCCACGGAGAAGGG + Intergenic
941715585 2:168760075-168760097 TGGGGGGATCTGAGGGAGGCTGG - Intronic
941918562 2:170828126-170828148 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918600 2:170828294-170828316 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918628 2:170828406-170828428 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918675 2:170828620-170828642 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918681 2:170828643-170828665 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918715 2:170828779-170828801 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918768 2:170829023-170829045 TGAGGACAGCTGAGGGAGGAGGG - Intronic
942946941 2:181682654-181682676 TCGGGGCAGCTGCCGGGTGAGGG - Intergenic
944106921 2:196089328-196089350 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
944629794 2:201612724-201612746 TGGGTGCAGCCCACGGAGCAGGG + Intronic
945235004 2:207625408-207625430 CGGGGGCACCTGCCGGAGGCTGG - Intronic
945390637 2:209261552-209261574 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
946321045 2:218954748-218954770 TGGGGGCAGATGAAAGAAGAGGG + Intergenic
948249947 2:236519209-236519231 TGGGGGAAGCTGACAGGCGAGGG - Intergenic
948419710 2:237849417-237849439 TGGGTGCAGCCCACGGAGCAGGG - Intergenic
948709806 2:239818681-239818703 TGGGGGAAGCTGTAGGAGGGAGG - Intergenic
948718860 2:239883526-239883548 CGGGGGCATCTGAAGTAGGATGG + Intergenic
948874903 2:240820986-240821008 TGGGGGCGGGTGACGCAGGCTGG - Intergenic
1168761035 20:349602-349624 AAGGTGCAGCTGACGGAGGGAGG - Intronic
1168874357 20:1160677-1160699 TGGGGGCACCTGACAGTGGAGGG - Intronic
1168882230 20:1216906-1216928 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
1168897625 20:1334711-1334733 TTGGGGGAGTTGACGGAGGTGGG + Intronic
1169121413 20:3098582-3098604 TGGGGGCACCTAATGGAGGCCGG - Intergenic
1169753664 20:9021505-9021527 TCGTGGCAGCTGAAGGATGAGGG + Intergenic
1171236571 20:23530989-23531011 TGGTGGCTGCTGACTGAGCAGGG + Intergenic
1172245557 20:33443250-33443272 TGGGGGCAGCCGAGGGCGCAGGG - Intronic
1172387861 20:34546742-34546764 AGATGGCAGCTGATGGAGGATGG + Intergenic
1172882877 20:38213153-38213175 GGGGGGCTGCTGCCGGAAGAAGG + Exonic
1173724379 20:45287099-45287121 TGGTGGGAGCTGATGGTGGAGGG - Intergenic
1174214009 20:48902215-48902237 AGGTGGCAGCTGCCAGAGGATGG - Intergenic
1174517617 20:51104788-51104810 TGGGGGCCTGTGACGGGGGAGGG + Intergenic
1175526779 20:59639703-59639725 TGGGTACTGCTGAGGGAGGAGGG + Intronic
1175889499 20:62310052-62310074 TGCGGGCGGATGACGGAGCAGGG - Exonic
1176048826 20:63105949-63105971 TGGGGGCAGCTGGCCCAGTAGGG + Intergenic
1176243251 20:64084704-64084726 AGAGGGCAGGTGACAGAGGAGGG + Intronic
1176804044 21:13462866-13462888 TGGGTGCAGTGGACTGAGGATGG + Intergenic
1178263833 21:31124395-31124417 TGGGGGCTGATGTAGGAGGACGG - Intronic
1178691511 21:34754124-34754146 TGGGGGCAGCAGTAGGAGGTGGG - Intergenic
1179455617 21:41497809-41497831 TGGGGACAGATGAGGCAGGATGG - Intronic
1179907751 21:44433039-44433061 TGGGGGCTGCGGTGGGAGGAGGG + Intronic
1180044029 21:45294563-45294585 CTGGGGCCGCTGTCGGAGGAAGG + Intergenic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180599043 22:17002130-17002152 TGGGTGCAGCCCACGGAGCAGGG - Intronic
1180956784 22:19744813-19744835 GGAGGGCAGCTGAAGGAGGGAGG + Intergenic
1182143305 22:27981058-27981080 TGGGGGCAGCTCACAGAGGCAGG + Exonic
1183259108 22:36782767-36782789 TGGGTGCAGCTGCCGGGGGAGGG - Intergenic
1183284661 22:36954265-36954287 TTGGGGCAGGTGAGGAAGGATGG - Intergenic
1183335757 22:37244920-37244942 TGGGGTCCGCTGATGGAGAAGGG + Intergenic
1184107507 22:42376750-42376772 TAGAGGCAGCTGAGGCAGGAGGG + Intergenic
1184458853 22:44626027-44626049 TGGGGGCAGCCTGAGGAGGAGGG - Intergenic
1184523154 22:45007575-45007597 AGGGGGCAGCGGAGGGAGGGAGG + Intronic
1184791536 22:46703346-46703368 TGGGGGCAGGAGAGGCAGGAGGG - Intronic
1185058924 22:48595392-48595414 TGGAGGCAGCTGACAGAGCAGGG + Intronic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
950091356 3:10297554-10297576 TGGGGGGAGGGGACGGGGGAGGG - Intronic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950227212 3:11245547-11245569 TGGGGGCAGCTGAAACAGTAAGG - Intronic
950358575 3:12433634-12433656 TGTGGTCAGCTGAGGGAGCATGG - Intronic
950362119 3:12456859-12456881 TGGGTGAAGCTGAAGGTGGACGG - Intergenic
950663485 3:14481369-14481391 TTGAGGCAGATGAGGGAGGAAGG + Intronic
952863095 3:37831155-37831177 TGGGGGCAGCTAAGGCAGGAGGG + Intergenic
953162001 3:40429557-40429579 TGGGAGTAGCTGAGGCAGGAGGG + Intergenic
953505603 3:43482914-43482936 TGCAGTCAGCTGAGGGAGGAGGG + Intronic
953978210 3:47398668-47398690 TGGGGGCTGCAGTGGGAGGATGG - Intronic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954536992 3:51368228-51368250 TGGGTGCAGCCCACGGAGCAGGG + Intronic
954704792 3:52473675-52473697 TGGGGACTTCTGACGGAGCAAGG + Intronic
956488384 3:69745438-69745460 TGGGGGCATTTAACAGAGGAAGG + Intronic
957330346 3:78755226-78755248 TGGAGGCAGATGCTGGAGGATGG + Intronic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
961087923 3:124085050-124085072 TGGGGGAAGCTGAAGGTGGTGGG - Intronic
961369991 3:126423201-126423223 TGTGGGCAGCTGGGAGAGGAGGG + Intronic
961444130 3:126970989-126971011 TGGGGGCAGGTGCTGGAGGGAGG + Intergenic
961530390 3:127536881-127536903 TGGGGGAAGCTGAAGCATGAAGG - Intergenic
961563306 3:127746385-127746407 TGGGGGCAGTTGAGGCAGGGTGG - Intronic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
962021107 3:131502790-131502812 TGGAGGCTGCTGACGCAGGTCGG - Exonic
963054513 3:141174830-141174852 TGGAGGCAGCTGACTCAGGGTGG - Intergenic
963847132 3:150170940-150170962 CGGGGGCAGTTGGCAGAGGAGGG - Intergenic
964499711 3:157335291-157335313 TGGGGGCTGCGGTGGGAGGATGG + Intronic
967055648 3:185826168-185826190 TGGGGTCAGCGGCCGGGGGACGG + Intergenic
968310688 3:197681041-197681063 TGGGGGGAGGGGACGGGGGAGGG + Intronic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968485879 4:861346-861368 AGTGGGCAGCTGAGGAAGGAGGG + Intronic
969339071 4:6529120-6529142 AGGGGGCAGCTGGAGGACGAGGG + Intronic
969492759 4:7509446-7509468 TGGGGGCAGCAGGGGGATGACGG + Intronic
969495869 4:7525862-7525884 AGGGGACAGGTGACTGAGGAGGG - Intronic
969495887 4:7525937-7525959 AGGGGACAGGTGACTGAGGAGGG - Intronic
969495905 4:7526009-7526031 AGGGGACAGGTGACTGAGGAGGG - Intronic
970906304 4:21220409-21220431 TGGGGTCAGGAGACGGGGGAGGG + Intronic
974253437 4:59419821-59419843 TGGGTGCAGCCCATGGAGGAGGG + Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
976222064 4:82763840-82763862 TGGGGGCAGCTGAGGAAAAAAGG - Intronic
977323716 4:95549283-95549305 TGGGGGGAGTTGGAGGAGGAGGG + Intergenic
977774342 4:100900292-100900314 TGGGTGCAGCTGAAGCAGGGTGG + Intergenic
978084093 4:104628932-104628954 TGTGGGCAGCAGAAGGAGAAAGG + Intergenic
978363541 4:107956858-107956880 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
979520098 4:121656097-121656119 TGGGGCCTGTTGAGGGAGGACGG + Intergenic
979976587 4:127204161-127204183 TGTGGGCTGCTGACACAGGAAGG + Intergenic
981034594 4:140156377-140156399 TGGAGGCAAGTGAAGGAGGAGGG - Intergenic
981153317 4:141404023-141404045 CGTGGGCAGCTGCAGGAGGAGGG - Intergenic
981182632 4:141763811-141763833 TGGGGCCAGGTGATGGAGGATGG + Intergenic
982139234 4:152301866-152301888 TGTGGCCAGCTGAGGCAGGATGG - Intergenic
982436115 4:155384492-155384514 TGGGGGCAGCTGATGGCCCAAGG - Intergenic
983183500 4:164676049-164676071 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984738893 4:183139750-183139772 TGGTGGCAGATGACGGGGGTAGG - Intronic
985649572 5:1101139-1101161 TCGGGGCAGGTGAGCGAGGAGGG - Intronic
985703312 5:1386544-1386566 TGCGGGCAGCTGGCGGAGCCAGG - Intergenic
985748889 5:1663385-1663407 TGGGGGCAGCAGACCGGAGAGGG - Intergenic
987878640 5:23712196-23712218 TGGGGGCTGCTGCAGGAGCAGGG + Intergenic
990320870 5:54628607-54628629 TGGGGGCAGCTGCCTGGAGAGGG - Intergenic
991173122 5:63652108-63652130 TGGGGGCAGATAATGGAGGAAGG + Intergenic
992525379 5:77605026-77605048 TGGGGGCAGAGGTGGGAGGAAGG + Intronic
997137704 5:131344174-131344196 TGGGTGCAGCCCACGGAGCAGGG + Intronic
1002398440 5:178976204-178976226 ATGGGGCAGCTGGCGGGGGATGG - Intergenic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003624105 6:7727073-7727095 GGGGGGCAGCTGCTGGGGGACGG + Exonic
1003995751 6:11538032-11538054 TGAGGACGGCGGACGGAGGAAGG - Intergenic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006409317 6:33863136-33863158 TGGGGGGAGGTGGAGGAGGAAGG + Intergenic
1006485269 6:34334696-34334718 TTTGGGAAGCTGAGGGAGGAGGG + Intronic
1007335282 6:41151030-41151052 TGAGGGGAGCTGACTGAGGTAGG + Intronic
1007360945 6:41355108-41355130 TGGGGTCAGGGGACGGGGGAGGG + Intergenic
1008530056 6:52448539-52448561 TGGGTGCAGCCCACGGAGCAGGG - Intronic
1008973603 6:57399181-57399203 TGGGGTCAGGGGATGGAGGAGGG - Intronic
1009162499 6:60300733-60300755 TGGGGTCAGGGGATGGAGGAGGG - Intergenic
1009289850 6:61868618-61868640 TGGGGGCAGGGGTCGGGGGAAGG + Intronic
1011065576 6:83321932-83321954 TGGGGGAAGCTGCCAGAGGAAGG + Intronic
1011501339 6:87993526-87993548 TGGATGCGGCTGACGGAAGAGGG + Intergenic
1013373464 6:109490904-109490926 TTGGGGCAGCAGCTGGAGGATGG + Intergenic
1013478299 6:110529902-110529924 GGAGGGGAGCTGACGGTGGAGGG - Intergenic
1013620152 6:111879958-111879980 GGGGGGCAGGAGGCGGAGGAAGG + Intergenic
1014574229 6:123050632-123050654 TGGGGGCAGATGATAGGGGATGG + Intronic
1015416747 6:132957836-132957858 TGGTGCCAGCTGAATGAGGAGGG + Intergenic
1015471782 6:133614441-133614463 TGGGTGCAGCCCACGGAGGGTGG + Intergenic
1015773435 6:136791881-136791903 CGGGGGCAGCCGACGGACCACGG - Exonic
1016265440 6:142227685-142227707 TGGGGCCTGCTGATGGTGGAAGG - Intergenic
1018047452 6:159978294-159978316 TGGGGGAATCTGAGTGAGGAAGG - Intronic
1018448293 6:163878893-163878915 TTGGGGCAGCTGGCCTAGGATGG + Intergenic
1018471362 6:164101175-164101197 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471369 6:164101195-164101217 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471391 6:164101257-164101279 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018803922 6:167244110-167244132 GTGAGGCTGCTGACGGAGGAGGG + Intergenic
1018803961 6:167244349-167244371 GCAGGGCTGCTGACGGAGGAGGG + Intergenic
1018803973 6:167244429-167244451 ATGAGGCTGCTGACGGAGGAGGG + Intergenic
1019267377 7:125406-125428 TGCGTGCAGCTGAAGGAGCACGG - Intergenic
1019268807 7:134416-134438 TGGGGTCAGCTGACGGAGACTGG - Intergenic
1019411085 7:907052-907074 TGCGGACGGCTGAGGGAGGAGGG - Intronic
1019415210 7:923899-923921 TGGGGGCAGACGTGGGAGGAAGG + Intronic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019975423 7:4577372-4577394 TGGGGGCAGAAGACGGATTAGGG + Intergenic
1020057457 7:5127825-5127847 TGGGGAAAGCTGACGTCGGAAGG - Intergenic
1020140811 7:5610637-5610659 TGGGGGCAGCAGAGGGAGAAGGG + Intergenic
1021483854 7:21146369-21146391 TGGGTGCAGCCCACGGAGGGGGG + Intergenic
1021744298 7:23723052-23723074 TGGGTGCAGCCCACGGAGCAGGG - Intronic
1021993216 7:26155975-26155997 TGGGGACAGGTGAAGGAGGGTGG - Intronic
1022453538 7:30537640-30537662 TGGGTGCAGCCCACGGAGCAGGG + Intronic
1022501890 7:30887120-30887142 TGGGGGTAGCTGAGGGAGGCGGG - Intronic
1023000228 7:35801028-35801050 AGGGGGCGGGGGACGGAGGAGGG + Exonic
1023142354 7:37114015-37114037 TGGGTGGAGTTGAGGGAGGAAGG + Intronic
1023828800 7:44027772-44027794 TGGGGGCAACCGGGGGAGGAAGG + Intergenic
1024601541 7:50985951-50985973 TGGAGGCAGCTGTCAGAAGAAGG - Intergenic
1026956141 7:74377447-74377469 TGGGTTCAGCTGAAGGAAGAAGG - Intronic
1027172646 7:75883650-75883672 TGGAGGCAGCAAAGGGAGGAGGG - Intronic
1027241936 7:76336347-76336369 TGGGGGCTGCTGAGGGAAGAAGG + Intronic
1028446472 7:90929194-90929216 TGGGTGCAGCCCACGGAGCAGGG - Intronic
1029692266 7:102190386-102190408 TGGGGGCTGCTGGCCGAGAAAGG - Intronic
1031755023 7:125628264-125628286 TGGAGGCAGCTGTTTGAGGAGGG - Intergenic
1032416779 7:131741608-131741630 TGGGAGGAGCTGAGGAAGGATGG - Intergenic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1034348068 7:150399082-150399104 TGGGGGCAGGAGGCCGAGGAGGG - Intronic
1035646945 8:1231792-1231814 TGGGGGCCGCTAGAGGAGGAAGG + Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036694963 8:10968232-10968254 TGGGGGCAGCTGACGGAGGACGG - Intronic
1037815905 8:22111752-22111774 GGGAGGCAGCTGAGGGAGGACGG + Intergenic
1037995959 8:23352543-23352565 TGGGGGCGGCAGAGGGTGGAGGG - Intronic
1038504814 8:28075188-28075210 GGGGGGCTGCTGACTGGGGAAGG + Intronic
1038792630 8:30681872-30681894 TGGGGGCAGGGGAAAGAGGAAGG + Intronic
1039170487 8:34739356-34739378 TGGGTGCAGCCCACGGAGCAGGG - Intergenic
1039467715 8:37796406-37796428 TGGAGGCAGCCGCAGGAGGATGG - Intronic
1039821515 8:41139273-41139295 TGGGCACAGCTGAGGCAGGAAGG - Intergenic
1040757146 8:50790446-50790468 TGGTGGAAGCTGTCGGTGGATGG + Intronic
1041388248 8:57326867-57326889 TGGGTGCAGCCCACGGAGCAGGG - Intergenic
1041725140 8:61011156-61011178 TGGGGGAAGCTGAGGCAGGAGGG + Intergenic
1042887527 8:73568982-73569004 TGGGTGCAGCACACGGAGCAGGG + Intronic
1043182669 8:77105673-77105695 TGGGGGCAGCCCACGGAGCAGGG + Intergenic
1043279392 8:78445012-78445034 TGGGTGCAGCCCACGGAGCAGGG + Intergenic
1048448772 8:134513026-134513048 ATGGGGCAGCTGACGGTGGAAGG + Intronic
1049201239 8:141341606-141341628 TGGGGGCAGAAGACAGAGGTTGG + Intergenic
1049235555 8:141510647-141510669 GGGTGGCTGCTGATGGAGGAGGG - Intergenic
1049235580 8:141510728-141510750 GGGTGGCTGCCGACGGAGGAGGG - Intergenic
1049310463 8:141931322-141931344 AGGGGGCAGCCTAAGGAGGAGGG + Intergenic
1049713814 8:144080100-144080122 TGGGTGCAGCTGTGTGAGGATGG - Exonic
1049780228 8:144425503-144425525 TGGGGGCTGGTGAGGGAGGCGGG - Intronic
1050049995 9:1589355-1589377 TGGGTGCAGCCCACGGAGCAGGG - Intergenic
1053201333 9:36153501-36153523 TGGGGGAGGCTGAGGCAGGATGG - Intronic
1053900733 9:42793088-42793110 TGGGGGCGGTGGCCGGAGGAGGG + Intergenic
1055587395 9:77769453-77769475 TGGGCACAGCTGCTGGAGGAAGG + Intronic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1057060954 9:92003711-92003733 TGGGGGGAGCTGACAGCCGAGGG - Intergenic
1057553163 9:96066851-96066873 TGGGGACAGCTGAGGGGGGCTGG + Intergenic
1058086065 9:100749432-100749454 TGGGTGCAGCCCACGGAGCAAGG - Intergenic
1058869666 9:109191065-109191087 TGGGGGAAGCAGATGGAGGGAGG + Intronic
1059903471 9:118954766-118954788 TGGGGGGAAGTGATGGAGGATGG + Intergenic
1060206039 9:121683373-121683395 TGGGGGCAGAGGAAGGAGGGAGG - Intronic
1060821473 9:126664014-126664036 TGGGTGCAGCTGGCGTGGGAGGG - Intronic
1062007655 9:134249317-134249339 TGGGGGCAGCTGATGGCTGGAGG + Intergenic
1185866928 X:3632377-3632399 TGCGGGCAGGTGAGGGAGGACGG - Intronic
1186735840 X:12463070-12463092 TGTGGTAAGCTGAGGGAGGATGG + Intronic
1186901865 X:14065823-14065845 TGGGGGGAGACGACGGAGCATGG + Intergenic
1187711377 X:22057890-22057912 TGGGGGCAGCTGACTGGGTAGGG + Intronic
1190062478 X:47219893-47219915 TGAGGGTATCTAACGGAGGAAGG + Intronic
1190320384 X:49176373-49176395 TGGGGGCAGGGGTCGGAGAATGG + Intronic
1192351961 X:70363385-70363407 TGGGGTCAGGGGACGGGGGAGGG - Intronic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1194329805 X:92567832-92567854 TGGGGCCTGCTGGAGGAGGAGGG + Intronic
1195082649 X:101385935-101385957 TGGAGGAGGCTGACGGAGGGTGG - Intronic
1195876776 X:109550423-109550445 TGGGGGAAGGTGAGGGAGAATGG + Intergenic
1196645848 X:118116812-118116834 GGGGGGCTGCTGAGGGAGGGGGG + Intronic
1196850457 X:119932876-119932898 TGGGGGCAGAGGTGGGAGGATGG + Intronic
1197758011 X:130009838-130009860 AGGGTGCAGCTGGCGGAGGCGGG - Intronic
1198581778 X:138073569-138073591 CGGGTGCAGCTCACGGAGCAGGG + Intergenic
1200059422 X:153477626-153477648 TGGGGGCAGCTGCCGAAGCTGGG - Intronic
1200638507 Y:5687014-5687036 TGGGGCCTGCTGGAGGAGGAGGG + Intronic
1200797069 Y:7350565-7350587 TGCGGGCAGGTGAGGGAGGATGG + Intergenic
1201953061 Y:19586423-19586445 TGGGTGCAGCTCATGGAGCAGGG - Intergenic