ID: 1036696817

View in Genome Browser
Species Human (GRCh38)
Location 8:10980200-10980222
Sequence CCTTCCAGGCAGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036696810_1036696817 -8 Left 1036696810 8:10980185-10980207 CCCCACTGAGAGGGGCCTTCCAG 0: 1
1: 0
2: 0
3: 56
4: 653
Right 1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG No data
1036696811_1036696817 -9 Left 1036696811 8:10980186-10980208 CCCACTGAGAGGGGCCTTCCAGG 0: 1
1: 0
2: 1
3: 30
4: 443
Right 1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG No data
1036696813_1036696817 -10 Left 1036696813 8:10980187-10980209 CCACTGAGAGGGGCCTTCCAGGC 0: 1
1: 0
2: 1
3: 28
4: 228
Right 1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036696817 Original CRISPR CCTTCCAGGCAGAGGCAGGA AGG Intronic
No off target data available for this crispr