ID: 1036698429

View in Genome Browser
Species Human (GRCh38)
Location 8:10994380-10994402
Sequence CAAGCCCTCCAGCGCTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036698429_1036698434 -8 Left 1036698429 8:10994380-10994402 CCCATGCAGCGCTGGAGGGCTTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1036698434 8:10994395-10994417 AGGGCTTGGGCTTAGGTCTGTGG No data
1036698429_1036698436 17 Left 1036698429 8:10994380-10994402 CCCATGCAGCGCTGGAGGGCTTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1036698436 8:10994420-10994442 TTCCAGCTTCTCAAAATGCAGGG No data
1036698429_1036698438 24 Left 1036698429 8:10994380-10994402 CCCATGCAGCGCTGGAGGGCTTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1036698438 8:10994427-10994449 TTCTCAAAATGCAGGGTGAGTGG No data
1036698429_1036698435 16 Left 1036698429 8:10994380-10994402 CCCATGCAGCGCTGGAGGGCTTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1036698435 8:10994419-10994441 GTTCCAGCTTCTCAAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036698429 Original CRISPR CAAGCCCTCCAGCGCTGCAT GGG (reversed) Intronic
900611964 1:3548064-3548086 CAGGCCCTCCCCAGCTGCATGGG + Intronic
901119758 1:6881575-6881597 CAAGCCCTGCGGGGCTGCACAGG - Intronic
902036807 1:13463965-13463987 CCAGCCCTCCAGTGCTTCAAGGG - Intergenic
902298254 1:15483192-15483214 CAAGCCCTCCAAAGCCCCATAGG + Intronic
903069862 1:20721798-20721820 CAGGCCCTGCAGCTCTGCCTCGG + Exonic
904684469 1:32250494-32250516 CAAGCCCTCCACCTCTGCCAGGG + Intergenic
905648202 1:39639441-39639463 CCAGCCCTCCAGCACCGCCTGGG - Intronic
910374349 1:86552706-86552728 CAAGCCCTCGAGCCCTTCACAGG + Intronic
914342447 1:146771550-146771572 CAAGCCCTGCAGCTCTGCGCAGG - Intergenic
917788801 1:178486752-178486774 CCAGCCCTCCAGCCCTGCTGCGG - Intergenic
920992497 1:210953180-210953202 TAAGCCCTCCAGCTCTGCTCTGG + Intronic
921466581 1:215494802-215494824 CTAGCCTTCCAGTGATGCATAGG + Intergenic
924458447 1:244237008-244237030 CTAGCCCTGCAGGGCTCCATGGG + Intergenic
1068285097 10:54923290-54923312 CAAGGCCTCCAGGCCTGTATTGG + Intronic
1075986977 10:126796749-126796771 GAAGGCCTCGAGCTCTGCATGGG + Intergenic
1078761817 11:14257856-14257878 CAGGACTTCCAGCCCTGCATGGG + Exonic
1079451493 11:20602951-20602973 CAATCCTTCCAGGGCTGCAAAGG - Intronic
1079666309 11:23110831-23110853 CAAGTCATCCAGAGCTGGATTGG + Intergenic
1080515187 11:33014004-33014026 CAAGTCCTCCCTCACTGCATGGG - Intergenic
1084730927 11:71073098-71073120 CAAGCCTTCCACCACTGCATGGG - Intronic
1088740394 11:112762345-112762367 CAAAACCTCCAGGGCTGCATGGG - Intergenic
1088763635 11:112956177-112956199 TAAGCCCTCCAGCCCTGAAGGGG - Intergenic
1089684936 11:120140733-120140755 CTAGTCCTCCAGCGATGCGTTGG - Intronic
1091440786 12:510653-510675 CAAACCCTGCAGAGCTGCTTTGG + Intronic
1093262334 12:16954125-16954147 AAAGCCCTCCTGGGCTGCCTGGG - Intergenic
1102468257 12:113143005-113143027 CAAGCCCTCCCGCCATGCTTCGG - Intergenic
1103083210 12:118041687-118041709 CAATTCCTCCAGCCCTGGATGGG - Intronic
1118634251 14:67733216-67733238 CAAGCCCTCCAGATTTGCTTTGG - Intronic
1124053499 15:26220848-26220870 CAAGCTCTCCCGTGCTGCAAAGG - Intergenic
1124935526 15:34166456-34166478 CAAGCCTTGCAGAGCTGCAGTGG - Intronic
1127387792 15:58481079-58481101 CAAGCCCTACAGCCCTCCATGGG + Intronic
1131086010 15:89576014-89576036 CAAGCCCCCGAGCGCGGCCTCGG - Exonic
1131316331 15:91341078-91341100 CACACCCACCAGCACTGCATGGG - Intergenic
1132645386 16:997124-997146 CAAAACCTCCACCCCTGCATGGG + Intergenic
1134475111 16:14566803-14566825 CTAGCCCTGCAGCACTGCAGGGG - Intronic
1134482185 16:14629815-14629837 CAAGTCCTCGAGGGGTGCATGGG + Intronic
1136463393 16:30425921-30425943 AAAGCCCTCCTGTCCTGCATGGG + Intronic
1138586353 16:57972789-57972811 CAAGCCCTTCTGCTCTGCTTGGG + Intergenic
1141317786 16:82978424-82978446 CAAGGCCTCCAGGCCTGCAATGG - Intronic
1144729265 17:17517410-17517432 CCAGCCCTCCATTGCTCCATCGG + Intronic
1146698493 17:34931413-34931435 CATGCCCTCCAGTTCTTCATAGG + Intronic
1149580403 17:57746207-57746229 CAAGCCATCCAAAGCTGAATTGG + Intergenic
1152205462 17:78972308-78972330 CAAGCCCTCCACCTCCTCATGGG + Exonic
1155003328 18:21706701-21706723 CCAGCCCGCCAGCGCTGCACTGG + Intronic
1157589676 18:48828874-48828896 CAAGCCGTCCAGGGCTGCGAAGG - Intronic
1161003856 19:1924779-1924801 CAAGCCCTCTATCACTGCAGGGG - Exonic
1165077979 19:33291326-33291348 TGACCCCTCCAGCCCTGCATCGG + Intergenic
931243237 2:60471103-60471125 CCAGCCCAGCAGCGCTACATGGG + Intronic
931570340 2:63662497-63662519 CAAGCCCTACAGAGCAACATGGG + Intronic
932539992 2:72641581-72641603 CAAGCCTTGCAGAGCTGCAGTGG - Intronic
934605481 2:95692006-95692028 TCTGCCCTCCAGAGCTGCATAGG + Intergenic
934789270 2:97044554-97044576 CAACCCCTCCTGTGCTGCCTAGG + Intergenic
935421380 2:102872358-102872380 CAAGCCCCCATGAGCTGCATAGG - Intergenic
936009494 2:108916432-108916454 CCAGCCCTGCAGGGCTGCAGAGG - Intronic
940202475 2:151166788-151166810 CCAGGTCTCCAGCGCTGGATAGG - Intergenic
941073698 2:160983940-160983962 CAAGCCCACCAGGGATGCATTGG + Intergenic
945116738 2:206415698-206415720 CAAGCCTTGCTGCGCTGCAGTGG + Intergenic
947829063 2:233125969-233125991 CAAGCCATCCAGCCCTGCCCTGG - Intronic
948676697 2:239601139-239601161 CCAGCGCTCCAGAGCTGCGTGGG - Intergenic
1168994776 20:2124996-2125018 CAAGTCCTGCAGAGCTGCAAGGG - Intronic
1172193494 20:33076591-33076613 TCAGCCCTCCAGGGCTGCAAGGG - Intergenic
1174342517 20:49906766-49906788 CGAGCCATCCTGAGCTGCATGGG - Exonic
1175683485 20:61008847-61008869 CAAGCACTCCAGCGCTCCCCAGG + Intergenic
1175919017 20:62441386-62441408 CAAGCGCTCCGGCTCTGCCTGGG - Intergenic
1176136283 20:63523402-63523424 CAAGCCCTCCAGCTCAGCCAAGG - Intergenic
1183368896 22:37421401-37421423 CAAACTCTCCAGCCCTGCCTGGG + Intronic
951026891 3:17840232-17840254 CAAACCCTCCAGCTCTGCTATGG - Intronic
954385530 3:50241972-50241994 CTAGGCCTCCAGCACTGCAGGGG + Intronic
956152559 3:66258959-66258981 CAAGTGCTCCATAGCTGCATGGG + Intronic
960974916 3:123164245-123164267 CAAGCCCTCCAGTGGGGCAGAGG - Intronic
962745439 3:138394499-138394521 CAAGCTATCCAGCGATGCCTGGG - Intronic
962804327 3:138916039-138916061 CAAGCCCTCGGGCGCGGTATGGG + Intergenic
964110144 3:153079127-153079149 TAACCCCTCCAGCGCTGCCTAGG + Intergenic
968869099 4:3232341-3232363 CTGGCCATCCAGCGCTCCATGGG + Intronic
969641821 4:8403365-8403387 CAGACCCTCCAGCCCTGGATGGG + Intronic
976158017 4:82168664-82168686 CTAGCCCTCCACCCCTCCATAGG - Intergenic
976823607 4:89234854-89234876 CAAGCCCTATAGAGCTACATTGG + Intergenic
980181410 4:129406167-129406189 CAAGCCCTCCAGTGATACAGGGG + Intergenic
984823754 4:183906386-183906408 CAAGCACTCCTGCGCTGAATCGG + Exonic
988647590 5:33111428-33111450 CAAGCCCACCAAGGATGCATGGG - Intergenic
989009551 5:36854963-36854985 AAAGCCGTCCTGGGCTGCATGGG + Intergenic
989196667 5:38723296-38723318 AAAGCCTTCCAACGCTGCCTTGG - Intergenic
989581865 5:43040970-43040992 CAAAACCGCCAGCTCTGCATAGG + Exonic
990355245 5:54960465-54960487 ACAGCCCTCCAGTGCTGCCTTGG + Intergenic
996117378 5:119633504-119633526 CCAGGCCTCCAGCACTGCAGCGG + Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1002618313 5:180468970-180468992 CAACCTCTCCAGCTCTGCCTGGG - Intergenic
1003908142 6:10720774-10720796 CCAGCCCACCGGCGCTGCGTTGG + Intergenic
1006503568 6:34473587-34473609 CCAGCCCTCCAGCCCTGCCTCGG - Intronic
1019634697 7:2069325-2069347 CCAGCCCCCGGGCGCTGCATGGG + Exonic
1019636705 7:2079869-2079891 CATGCCCTCCAGCTCTGACTTGG + Intronic
1019644109 7:2120029-2120051 CAGGCCCTCCAGCTCTCCCTGGG + Intronic
1023721146 7:43096102-43096124 AAAGCCATCCTGGGCTGCATGGG + Intergenic
1025260443 7:57414495-57414517 CCAGCCCACCAGGGCTGGATTGG + Intergenic
1033215578 7:139491111-139491133 CAATCCCACAAGTGCTGCATTGG - Intergenic
1035076248 7:156179409-156179431 GAAGCCTTCCAGCCCTGCTTGGG + Intergenic
1035575914 8:704843-704865 CACACCCTCCAGCTCTGCAGTGG - Intronic
1036224266 8:6944684-6944706 CCACCCCTCCAGCCATGCATGGG - Intergenic
1036698429 8:10994380-10994402 CAAGCCCTCCAGCGCTGCATGGG - Intronic
1040074540 8:43215706-43215728 CCAACCCCCCAGCACTGCATGGG + Intergenic
1040319877 8:46287099-46287121 GAAGCCCTCCAGCGCCCCCTGGG - Intergenic
1040695384 8:49991326-49991348 CAATCCCACCAGCCTTGCATCGG - Intronic
1044521578 8:93205352-93205374 CAAGCCTTGCAGCACTGCAGTGG + Intergenic
1044798939 8:95933539-95933561 CAAGCCTTGCAGCACTGCAGTGG + Intergenic
1046265381 8:111823466-111823488 CCAGCCCACCGGTGCTGCATTGG - Intergenic
1049795859 8:144497002-144497024 CATGCCCCCCAGGGCTGCCTGGG + Exonic
1050978029 9:11967037-11967059 CAAGCCCTCTAGAGCTTCAGGGG + Intergenic
1059810631 9:117852210-117852232 CCAGCCCACCGGCGCTGCACTGG + Intergenic
1061978712 9:134087512-134087534 CATGCCCTTCACAGCTGCATGGG - Intergenic
1062044783 9:134419984-134420006 CAAGCCCTCCTGGGCTGGCTGGG - Intronic
1185469126 X:372045-372067 GAAGCCCTTCAGCCCTGCAGTGG - Intronic
1185506299 X:634152-634174 CCAGCCCTCCTGCGCTGCAGCGG + Intronic
1190284264 X:48951683-48951705 CAAGCCCTCCAGGGCAGAAGGGG + Intronic
1196376301 X:115036615-115036637 CAAGCCCCCAAGCACAGCATAGG + Intergenic
1196850746 X:119935910-119935932 TAAGCCTTACAGGGCTGCATCGG - Intronic