ID: 1036699689

View in Genome Browser
Species Human (GRCh38)
Location 8:11004088-11004110
Sequence TCGCTCCATCTCTGCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 198}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036699689_1036699692 -5 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699692 8:11004106-11004128 AGCGAAGTCTGGGAGTTATGAGG No data
1036699689_1036699694 4 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699694 8:11004115-11004137 TGGGAGTTATGAGGAGCCCTGGG No data
1036699689_1036699696 13 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699696 8:11004124-11004146 TGAGGAGCCCTGGGAGTCTTGGG No data
1036699689_1036699699 19 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699699 8:11004130-11004152 GCCCTGGGAGTCTTGGGCTGGGG No data
1036699689_1036699693 3 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699693 8:11004114-11004136 CTGGGAGTTATGAGGAGCCCTGG No data
1036699689_1036699698 18 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699698 8:11004129-11004151 AGCCCTGGGAGTCTTGGGCTGGG No data
1036699689_1036699697 17 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699697 8:11004128-11004150 GAGCCCTGGGAGTCTTGGGCTGG No data
1036699689_1036699695 12 Left 1036699689 8:11004088-11004110 CCTGAGCTGCAGAGATGGAGCGA 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1036699695 8:11004123-11004145 ATGAGGAGCCCTGGGAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036699689 Original CRISPR TCGCTCCATCTCTGCAGCTC AGG (reversed) Intronic
900302837 1:1986518-1986540 TGGCTCCACGGCTGCAGCTCTGG - Intronic
900326335 1:2110352-2110374 TTCTTCCCTCTCTGCAGCTCCGG + Intronic
903323221 1:22554778-22554800 TGGCTCCATCACTGCAGGGCAGG - Intergenic
903923386 1:26817286-26817308 CCGCTTCATATCTGCAGCTGGGG - Intergenic
904794786 1:33051156-33051178 CCGCTTCATATCTGCAGCTGGGG - Intronic
906075050 1:43046004-43046026 ACTCTCCATTCCTGCAGCTCTGG + Intergenic
906436890 1:45803882-45803904 CCGCTTCATATCTGCAGCTGGGG - Exonic
906486616 1:46240317-46240339 CCGCTTCATATCTGCAGCTGGGG - Intergenic
908472287 1:64456028-64456050 TCCCTTTATCTCTGCAGCTTAGG - Intergenic
913193022 1:116429686-116429708 TCCCTTCCTCTCTGCACCTCTGG + Intergenic
914521284 1:148419039-148419061 TCTCTCCCTCTCTCCTGCTCTGG - Intergenic
914867603 1:151445015-151445037 GCTCTCCAGCTCTCCAGCTCAGG - Intronic
915152336 1:153844019-153844041 CTGCTCCATCTCTTCAACTCAGG - Intronic
915173753 1:153997540-153997562 TCACTCCATCTCTGCCTCCCAGG + Intronic
915566263 1:156714841-156714863 TTGCTGCATCTGCGCAGCTCAGG + Intergenic
919938939 1:202273278-202273300 TACCTCCTTCTCTGAAGCTCAGG - Intronic
920503810 1:206502139-206502161 TTCCTCCATCTCTCCATCTCTGG + Intergenic
920775898 1:208936865-208936887 TTGCTCCTTCTCTGGGGCTCGGG - Intergenic
921414485 1:214870602-214870624 CCGCTTCATATCTGCAGCTGGGG + Intergenic
1064128442 10:12685711-12685733 TCTCTCAATCTCTCCAGCCCAGG - Intronic
1065155723 10:22868567-22868589 TCTCACCCTTTCTGCAGCTCTGG - Intergenic
1065780838 10:29165424-29165446 CCACTCCATCTCTTCAACTCAGG - Intergenic
1066453502 10:35552343-35552365 TTCCTCCCTCTCCGCAGCTCCGG - Intronic
1069877056 10:71569308-71569330 CAGCTCCATCTCTGCAGGCCAGG + Intronic
1070156072 10:73836439-73836461 TGGCTCCATCCATGTAGCTCAGG + Intronic
1072950160 10:99840285-99840307 CCGCTTCATATCTGCAGCTGGGG + Intronic
1076673935 10:132137950-132137972 TGGCTCCAGCTCTGCTCCTCGGG - Intronic
1080899009 11:36469800-36469822 CCACTCAATGTCTGCAGCTCTGG - Intergenic
1082220627 11:49631373-49631395 TCACTTCATCACTGCATCTCAGG + Intergenic
1083955601 11:65981363-65981385 TTGCTTCCTCTCTGCATCTCTGG + Intergenic
1084159661 11:67339888-67339910 TCACTCCACCTCTGGGGCTCAGG + Intronic
1084376531 11:68781992-68782014 ACGCTCCATCGCTGCAGGTCGGG - Intronic
1085426686 11:76411087-76411109 TGGCTCCATCACCGCAGCTGAGG - Intronic
1085630432 11:78111218-78111240 TTACTCCATCTCTGTACCTCAGG - Intronic
1086238022 11:84655555-84655577 GAGCTCCATCTCTCCAGATCTGG - Intronic
1086629044 11:88993804-88993826 TCACTTCATCACTGCATCTCAGG - Intronic
1087492034 11:98840387-98840409 TCGATCCATCCTTGCATCTCTGG + Intergenic
1088371175 11:109090011-109090033 TGGCACCATCTCTGGAGCTATGG - Intergenic
1090501872 11:127268732-127268754 TCTCTCCATTTTTTCAGCTCTGG - Intergenic
1090722152 11:129485574-129485596 TCTCTCCTTCTCTGCAGAACGGG - Intergenic
1092031866 12:5293222-5293244 TCGCACCCTCACTGCACCTCTGG - Intergenic
1095439309 12:42227015-42227037 CCGCTTCATATCTGCAGCTGGGG - Intronic
1096497010 12:52044398-52044420 TCTCTCCAGCTCTGCTTCTCAGG - Intronic
1097038009 12:56136834-56136856 TGGTTCCAGCTCAGCAGCTCTGG + Exonic
1099833979 12:87883060-87883082 TTGCTCTATCTCTGCAGCGAAGG - Intergenic
1103231014 12:119330479-119330501 TCTTTCCATTTCTGCAACTCTGG + Intergenic
1104583303 12:130026907-130026929 ATGCTCCATCTCTGGAGCTGGGG + Intergenic
1107272998 13:38642636-38642658 TCTCTCTCTCTCTGCATCTCAGG - Intergenic
1108059386 13:46517526-46517548 CCACTCCACCACTGCAGCTCCGG + Intergenic
1108259894 13:48646026-48646048 TCCCTGTATCTCTGCAGCCCAGG - Intergenic
1108757468 13:53521403-53521425 ACACTCCATCTCTTCAGCTTTGG - Intergenic
1109220527 13:59636750-59636772 TTGCACCATCCCTGTAGCTCAGG + Intergenic
1110062191 13:71056204-71056226 TCTCTCCCTCTCTGCAGTGCTGG - Intergenic
1113175363 13:107557571-107557593 TGGCTCTGTCTCTGCTGCTCTGG + Intronic
1113786452 13:113004410-113004432 TCACTCCATGTCTGCAGCTGGGG + Intronic
1115396843 14:32918423-32918445 TCTCATCATCTCTGAAGCTCAGG - Intergenic
1117637548 14:57761009-57761031 TAGCTCTATCTCTTCACCTCAGG + Intronic
1118615402 14:67571717-67571739 CCCCTCCCTCACTGCAGCTCAGG - Intronic
1119027131 14:71162969-71162991 TCTTTCCAGCTATGCAGCTCTGG - Intergenic
1119320313 14:73726532-73726554 TGGATCCATGTCTGCTGCTCAGG - Intronic
1122021511 14:98841644-98841666 ACTCTCCATCTCTGGGGCTCTGG - Intergenic
1122964058 14:105112855-105112877 CCGCTTCATATCTGCAGCTGGGG + Intergenic
1124239615 15:28018816-28018838 TCCCTCCATCTTTGGAGCTAAGG - Intronic
1125092731 15:35813155-35813177 TCTCCAAATCTCTGCAGCTCTGG + Intergenic
1128686807 15:69692624-69692646 TAGCTCCATCTCTCCCGCTCTGG - Intergenic
1128778712 15:70343353-70343375 GCCCTCCAGCTCTGCAGCTGTGG - Intergenic
1128944803 15:71812925-71812947 TAGTTCAATCTCTCCAGCTCTGG + Intronic
1129428239 15:75480647-75480669 CCGCTTCATATCTGCAGCTGGGG - Intronic
1132713316 16:1278756-1278778 TGGCGCCCTCTCTCCAGCTCTGG - Intergenic
1133033479 16:3022418-3022440 TCACTCCCTCCCTCCAGCTCAGG - Intergenic
1135497151 16:22962683-22962705 TGGCCCCATCCCTGCAGCTCTGG + Intergenic
1135972032 16:27079213-27079235 TCCCTAGGTCTCTGCAGCTCAGG - Intergenic
1137023635 16:35453456-35453478 TGGCCCCATCTTCGCAGCTCTGG + Intergenic
1139577150 16:67848778-67848800 CAGCTCAATCTCTGCAGCTCTGG + Intronic
1141225617 16:82112104-82112126 TCGTTTCATCTATGCAACTCTGG - Intergenic
1141862840 16:86729672-86729694 TAGCTCCAGCTCTGCAGCCTGGG + Intergenic
1141942137 16:87284071-87284093 CCACTCCATGCCTGCAGCTCTGG + Intronic
1146838895 17:36135796-36135818 GCCCTCCATCTCTGCATGTCAGG - Intergenic
1147314130 17:39611589-39611611 TCACTGCATCTCTGCATCTCTGG - Intergenic
1147649123 17:42051886-42051908 GCGCTCCATCCCAGCAGCTCTGG - Intronic
1147963148 17:44179858-44179880 CCGCTTCATATCTGCAGCTGGGG - Intergenic
1149550950 17:57539129-57539151 TCCCTCCGTCTCTGTATCTCAGG - Intronic
1149591196 17:57831069-57831091 CTGCCCCTTCTCTGCAGCTCAGG - Intergenic
1149789150 17:59462158-59462180 TCGCCCCATCTCTGGAGAGCTGG - Intergenic
1150689279 17:67350542-67350564 TGGCTGCATCTCTGCATCTGAGG - Intronic
1150916698 17:69444630-69444652 TCTCTCCATGTCTGCATCACTGG + Intronic
1151517319 17:74604950-74604972 TCGCTCCAACTCTCCAGCCAAGG + Intergenic
1151652902 17:75481133-75481155 TCCCTCCATGTCAGGAGCTCCGG + Intronic
1152224243 17:79085401-79085423 CCCCTCCATCCCTCCAGCTCTGG - Intronic
1152297506 17:79476690-79476712 TGGTTCCTTCTCTGCAGTTCTGG - Intronic
1153215633 18:2817963-2817985 TCTCTCTGTCTCTGCAGCCCAGG - Intergenic
1154425671 18:14270259-14270281 TGCCTGCATCCCTGCAGCTCTGG + Intergenic
1157359183 18:46962963-46962985 TGGCTCCATCTCTCCATTTCCGG + Exonic
1157360177 18:46968890-46968912 TGGCTCCATCTCTCCATTTCCGG + Exonic
1157360778 18:47022482-47022504 TGGCTCCATCTCTCCATTTCCGG + Exonic
1157361767 18:47028397-47028419 TGGCTCCATCTCTCCATTTCCGG + Exonic
1161385150 19:3987710-3987732 TGGCTCCATCCCTGCAGTTATGG - Intergenic
1162886655 19:13702616-13702638 CCGCTTCATATCTGCAGCTGGGG - Intergenic
1164191874 19:22925363-22925385 CCGCTTCATATCTGCAGCTGGGG - Intergenic
1164653376 19:29901861-29901883 CCGCTTCATATCTGCAGCTGGGG + Intergenic
1165025858 19:32960920-32960942 CAGCTCCATCTCTGCAACTCAGG - Intronic
1166261392 19:41644042-41644064 CCGCTTCATATCTGCAGCTGGGG - Intronic
1167621865 19:50565228-50565250 GGGCTGCATCTCTGTAGCTCTGG + Intronic
926948815 2:18218895-18218917 TATCTACATCACTGCAGCTCAGG - Intronic
930896176 2:56449236-56449258 TCGCTCCATTCCTCCAGCTCTGG - Intergenic
931011799 2:57925029-57925051 TTGCTCCATCTTTGCATCCCTGG + Intronic
931694401 2:64860627-64860649 TCCCTCCAGCTATGCAGCTCAGG + Intergenic
932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG + Intronic
936743900 2:115550012-115550034 CAACTCCATCTATGCAGCTCAGG + Intronic
938319668 2:130354755-130354777 TCGCTCCATCACTTCAGCCAAGG + Intergenic
939991062 2:148876634-148876656 TAGCTCCCTCTCTGCAGCTGGGG + Intronic
940905856 2:159168872-159168894 TAGATTCTTCTCTGCAGCTCTGG - Intronic
941060968 2:160846551-160846573 TTACGCCATCTCTGCATCTCTGG - Intergenic
942967231 2:181910830-181910852 TCACTCGGTCACTGCAGCTCTGG + Intronic
943942646 2:194020015-194020037 TCGCTCACTCTCCGCACCTCCGG + Intergenic
944637134 2:201685205-201685227 TCCCTCAATCAATGCAGCTCTGG + Intronic
946025409 2:216669081-216669103 TCTCTCCATCTCCCCAGCCCTGG - Intergenic
946134128 2:217631621-217631643 TCGCTCCATCGCTACACCACTGG - Intronic
948707167 2:239802000-239802022 GAGCTCCCTCTCTGCAGCTCCGG - Exonic
1168974983 20:1958076-1958098 CAGCTCCATCTCTTCAACTCAGG - Intergenic
1171393050 20:24813731-24813753 TATGTCCATCACTGCAGCTCTGG + Intergenic
1172787094 20:37475591-37475613 CCACCCCAACTCTGCAGCTCTGG + Intergenic
1173552254 20:43940636-43940658 TCCCTCCATCCCTGCGACTCTGG - Intronic
1174124894 20:48297146-48297168 CATCTCCATCTCTGCACCTCGGG + Intergenic
1174914433 20:54639971-54639993 GCCCACCATCTCTGCAGCTCTGG + Intronic
1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG + Intronic
1178309447 21:31517570-31517592 TTGCTCCATCTCTGCCGCTGTGG - Intronic
1181260115 22:21591490-21591512 ACTCTCCCTCTCTGCTGCTCTGG + Intronic
1181329124 22:22075384-22075406 GCCCTCCCTCTCTGCACCTCCGG + Intergenic
1181333359 22:22111607-22111629 ACCCTCCCTCTCTGCATCTCTGG + Intergenic
1181567160 22:23746034-23746056 TCACTGCCACTCTGCAGCTCAGG + Intronic
1182718218 22:32376877-32376899 GCCCTCCCTCTCTGCATCTCTGG + Intronic
1183275660 22:36895947-36895969 TCCCTGCATCCCTGCTGCTCTGG + Intergenic
1183972598 22:41489148-41489170 TCCTTCCATCTCAGCATCTCAGG + Intronic
950253905 3:11488465-11488487 CCGCTTCATATCTGCAGCTGGGG + Intronic
950517332 3:13475963-13475985 TCCCTTCATCTGTGCAGCTGAGG + Intergenic
950612574 3:14135635-14135657 TGCATCCACCTCTGCAGCTCTGG - Intronic
952336760 3:32410265-32410287 TGGCTGCCCCTCTGCAGCTCAGG - Intronic
954080484 3:48210704-48210726 CCGCTTCATATCTGCAGCTGGGG - Intergenic
954082344 3:48219977-48219999 TGGCTCCGTGTCTGCAGCCCTGG - Intergenic
954391258 3:50269227-50269249 CCGCCCCATCTCAGCAGCTCAGG - Exonic
955501207 3:59584806-59584828 TCACTCCAGCTCTGTAGCCCAGG - Intergenic
956876298 3:73467091-73467113 CTGCACCATCTCTGCAGCTGGGG - Intronic
960648008 3:119911349-119911371 TTGCTCCATTTATGCAGCACAGG + Intronic
961350105 3:126294663-126294685 TTGCCCCATCTCTGCTGCTGAGG + Intergenic
961444029 3:126970262-126970284 TGGGTTCCTCTCTGCAGCTCAGG + Intergenic
969838671 4:9864357-9864379 CCCCTCCAGCTCTACAGCTCTGG - Intronic
970074129 4:12198147-12198169 TGGTTCCAACTTTGCAGCTCTGG - Intergenic
975491283 4:74991505-74991527 TCTCTCTCTCTCTGCATCTCTGG - Intronic
981104007 4:140859739-140859761 TAGCACCACCTCTGCAACTCAGG + Intergenic
981555285 4:145986955-145986977 TGGCTCCATCTTGGCAGCCCAGG + Intergenic
981721058 4:147801821-147801843 TTTCTCCATCTCTGCAGCAGAGG - Intronic
982616142 4:157637913-157637935 CCGCTTCATATCTGCAGCTGGGG + Intergenic
986918469 5:12655941-12655963 TAGCTCCATCTCTTCAACCCAGG - Intergenic
988923069 5:35962464-35962486 TCCCTCCAGCTCTGCTCCTCTGG - Intronic
990032506 5:51278688-51278710 TCTCTCTGTCTCTACAGCTCAGG - Intergenic
990324294 5:54659829-54659851 TCGCCTCACCTCTGCCGCTCTGG + Intergenic
990980131 5:61594868-61594890 CCTCTTCATCTCTGCATCTCTGG + Intergenic
993185416 5:84612441-84612463 TCGCTCCAACAAAGCAGCTCTGG + Intergenic
995611107 5:113911159-113911181 TCTCTCCACCTCTGCAGCCAAGG - Intergenic
998391397 5:141789106-141789128 TTTCTCCATCTCTGCAGCCCAGG + Intergenic
999151424 5:149428828-149428850 GGGCTCCACCTCTCCAGCTCTGG - Intergenic
1000038941 5:157470696-157470718 TTGCTCTATCTCTGCTCCTCGGG - Intronic
1002341455 5:178518962-178518984 CCGCTTCATATCTGCAGCTGGGG + Intronic
1002450593 5:179316333-179316355 TTGCTAGATCTCTGCTGCTCTGG - Intronic
1002843098 6:922835-922857 TCCCTCCATCCCTGCTTCTCTGG + Intergenic
1004339575 6:14796513-14796535 TTGCTCCATATCACCAGCTCTGG + Intergenic
1006829309 6:36959133-36959155 TCGTCCCATCTCTGCAGGGCAGG - Exonic
1007270499 6:40632541-40632563 CCCTTCCATCTTTGCAGCTCTGG - Intergenic
1007674470 6:43581712-43581734 CCGCTTCATATCTGCAGCTGGGG + Intronic
1011603407 6:89080619-89080641 TCGCTCCGCCTCCGCAGCTTCGG - Intergenic
1013644181 6:112119441-112119463 TGGCCCCATCTCTGAAGGTCAGG + Intronic
1015476496 6:133664146-133664168 CCGCTTCATATCTGCAGCTGGGG - Intergenic
1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG + Intronic
1019443068 7:1057039-1057061 TCCCTCCCTCCCGGCAGCTCAGG - Intronic
1019637047 7:2081563-2081585 TCCCTGCATCACTGCAGCCCAGG + Intronic
1019997489 7:4734175-4734197 CCGCTCCTTCTCAGGAGCTCTGG - Intronic
1022477573 7:30721879-30721901 TCCCTCCATCTCTGCAGTTGGGG + Intronic
1023640603 7:42253299-42253321 TTGCTCCATGGCTGCTGCTCGGG + Intergenic
1026441765 7:70451079-70451101 TAGCTCCATCTCTGCTACTAAGG - Intronic
1032322162 7:130895498-130895520 TCTCTCCAGCTCTGCAGCTCGGG + Intergenic
1032581164 7:133104849-133104871 TCACTCTATCCGTGCAGCTCAGG - Intergenic
1033666262 7:143443557-143443579 TGGCTTCATCACTGCTGCTCTGG + Exonic
1034164539 7:149015182-149015204 TGGCTGCATCTCTGCAGTTTTGG + Intronic
1035600939 8:896385-896407 TCACACCATCCCGGCAGCTCAGG - Intergenic
1036699689 8:11004088-11004110 TCGCTCCATCTCTGCAGCTCAGG - Intronic
1038582139 8:28757284-28757306 TCCCTCCCTCTCTGAATCTCTGG + Intergenic
1041260882 8:56019622-56019644 TGGCTCCATCTGTGCAGCAGAGG + Intergenic
1041320185 8:56604505-56604527 ATGCTCCATCTCTGCACCTTTGG - Intergenic
1042461989 8:69080440-69080462 TCCCTACATCCCTGCAGCCCAGG - Intergenic
1043877728 8:85505397-85505419 TCGCTCCATCACTCCAGCTCAGG - Intergenic
1047428457 8:124767916-124767938 TGGCTCCTTCTCTCCAGTTCAGG - Intergenic
1047687080 8:127315736-127315758 CCGCTTCATATCTGCAGCTGGGG - Intergenic
1049416621 8:142498357-142498379 TCACTCCCTCTCTGGAGCTGGGG + Intronic
1051552737 9:18348262-18348284 TCCCTCCATCTGTTCAGCTAGGG - Intergenic
1053457030 9:38241407-38241429 CCGCTTCATATCTGCAGCTGGGG - Intergenic
1054904207 9:70400574-70400596 TCTCTCCATTTCTGCTGCTGGGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056773387 9:89495730-89495752 TAGCTCCAACCCTGGAGCTCTGG + Intronic
1057968132 9:99524660-99524682 TCACTCCATCTCAGCTGTTCAGG + Intergenic
1059305565 9:113350528-113350550 TCTCCCAATCTCAGCAGCTCAGG - Intronic
1060064741 9:120494920-120494942 CCGCTTCATATCTGCAGCTGGGG - Intronic
1061050249 9:128191121-128191143 TCCCTCCATCTCTCCATTTCTGG + Intronic
1061751217 9:132778314-132778336 TAACTCCATTACTGCAGCTCTGG - Intronic
1062095765 9:134702331-134702353 TTGTCCCATCTCTGCAGCCCTGG - Intronic
1185459422 X:328037-328059 TGGCTCCCTCTCTGCACCCCAGG + Intergenic
1186818978 X:13266962-13266984 TCTGTCCATCACTGCAACTCCGG - Intergenic
1189553386 X:42115966-42115988 TTGTTCCATCCCTGTAGCTCTGG + Intergenic
1189775637 X:44468169-44468191 TTGCTCTCTCTCAGCAGCTCTGG - Intergenic
1191105399 X:56769138-56769160 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191106392 X:56774540-56774562 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191107385 X:56779942-56779964 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1192505396 X:71678282-71678304 TCTCTCCCTCTCTTTAGCTCTGG + Intergenic
1192621042 X:72680701-72680723 CCGCTTCATATCTGCAGCTGGGG - Intronic
1196396703 X:115271383-115271405 GCTCTGCAGCTCTGCAGCTCTGG + Intergenic
1199443987 X:147900065-147900087 CAGATCCATCTGTGCAGCTCAGG + Intergenic
1199990461 X:152984819-152984841 TCTCTCCATCCCCTCAGCTCAGG + Intergenic
1200033551 X:153314293-153314315 TCTCTCCATCCCCTCAGCTCAGG + Intergenic
1201340044 Y:12924319-12924341 TCCCTCCAGCTCTGCTCCTCTGG - Intergenic