ID: 1036700094

View in Genome Browser
Species Human (GRCh38)
Location 8:11007740-11007762
Sequence GTGGAGGAACAGAGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036700087_1036700094 0 Left 1036700087 8:11007717-11007739 CCTGGTTGCTGTAAGGGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG No data
1036700080_1036700094 17 Left 1036700080 8:11007700-11007722 CCCAGATCTTACCTACTCCTGGT 0: 1
1: 0
2: 2
3: 11
4: 115
Right 1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG No data
1036700083_1036700094 6 Left 1036700083 8:11007711-11007733 CCTACTCCTGGTTGCTGTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG No data
1036700081_1036700094 16 Left 1036700081 8:11007701-11007723 CCAGATCTTACCTACTCCTGGTT 0: 1
1: 0
2: 2
3: 10
4: 100
Right 1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036700094 Original CRISPR GTGGAGGAACAGAGGCAGCA GGG Intronic
No off target data available for this crispr