ID: 1036701214

View in Genome Browser
Species Human (GRCh38)
Location 8:11015289-11015311
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036701213_1036701214 -1 Left 1036701213 8:11015267-11015289 CCTCTCATGCTGCACTTTTATTT 0: 1
1: 0
2: 5
3: 24
4: 336
Right 1036701214 8:11015289-11015311 TTTACTCTTCTGAGCACATCCGG No data
1036701212_1036701214 19 Left 1036701212 8:11015247-11015269 CCTTAGCATTGCTCTGAAATCCT 0: 1
1: 0
2: 4
3: 54
4: 218
Right 1036701214 8:11015289-11015311 TTTACTCTTCTGAGCACATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr