ID: 1036701703

View in Genome Browser
Species Human (GRCh38)
Location 8:11017568-11017590
Sequence GGCCCAGGGTCTCTGAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036701703_1036701711 5 Left 1036701703 8:11017568-11017590 CCGGCACTCAGAGACCCTGGGCC 0: 1
1: 0
2: 4
3: 33
4: 337
Right 1036701711 8:11017596-11017618 GAGAGGGGCTGACATTATGGTGG No data
1036701703_1036701712 6 Left 1036701703 8:11017568-11017590 CCGGCACTCAGAGACCCTGGGCC 0: 1
1: 0
2: 4
3: 33
4: 337
Right 1036701712 8:11017597-11017619 AGAGGGGCTGACATTATGGTGGG No data
1036701703_1036701710 2 Left 1036701703 8:11017568-11017590 CCGGCACTCAGAGACCCTGGGCC 0: 1
1: 0
2: 4
3: 33
4: 337
Right 1036701710 8:11017593-11017615 CTCGAGAGGGGCTGACATTATGG No data
1036701703_1036701706 -10 Left 1036701703 8:11017568-11017590 CCGGCACTCAGAGACCCTGGGCC 0: 1
1: 0
2: 4
3: 33
4: 337
Right 1036701706 8:11017581-11017603 ACCCTGGGCCTGCTCGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036701703 Original CRISPR GGCCCAGGGTCTCTGAGTGC CGG (reversed) Intronic
900090325 1:917383-917405 GGCCCAGGGGCTCTGGCTGTGGG + Intergenic
900125649 1:1067955-1067977 GGCCCAGGGCTACTGCGTGCGGG + Intergenic
900229697 1:1550516-1550538 GGCACTGATTCTCTGAGTGCTGG - Intronic
900693617 1:3996509-3996531 CGCCCAGGGCCACTGAGAGCAGG - Intergenic
900795810 1:4707714-4707736 GGCCCTGGGCCTCCCAGTGCAGG + Intronic
900924175 1:5692605-5692627 AGCCCAGGGCCCCTGAGGGCTGG + Intergenic
901852117 1:12022280-12022302 GGCCCAGGGACTCCTGGTGCTGG - Exonic
902038256 1:13473359-13473381 GGCCCAGGGTCTCTGTAAGAAGG + Intergenic
902194144 1:14785307-14785329 GGCTCAGTGTCTCTCAGTTCAGG + Intronic
902799463 1:18820218-18820240 GGGCCAGGGTCTCTGCGCACTGG + Intergenic
903071264 1:20728000-20728022 GCCGCAGGGCCTCTGACTGCGGG - Exonic
903647941 1:24905955-24905977 GGCCCAGCCTCTCTGAGCCCAGG - Intronic
903651222 1:24923482-24923504 AACCCAGGCTCTCTGAGGGCTGG + Intronic
903946124 1:26964299-26964321 GGCCCAGTATCTTTGAGTGAGGG - Intergenic
904094414 1:27966195-27966217 GGCCCAGGGGTGCTGAGTGCTGG + Intronic
904207828 1:28866135-28866157 GGCTCAGGCTTTCTGAGGGCAGG - Intergenic
904403696 1:30273026-30273048 GGCCCAGGGTCCCAGAGACCTGG + Intergenic
904791250 1:33023311-33023333 GCCCCAGCCTCTCTAAGTGCTGG - Intronic
905627609 1:39498930-39498952 GCCCAAAGGGCTCTGAGTGCCGG + Intronic
906528445 1:46509881-46509903 GGCCTAGAGTCTCTGATGGCAGG - Intronic
907123430 1:52028072-52028094 GGCCCAGCCTCCCAGAGTGCTGG + Intronic
908322847 1:62994720-62994742 GGCCCACTGACTCTGAGTCCAGG + Intergenic
908820919 1:68085732-68085754 AGTCCAGGATCTCTGAGTGATGG - Intergenic
909366497 1:74829512-74829534 GGGCCAGGCTGTCTGAGTGCTGG - Intergenic
912538773 1:110396616-110396638 GGGCCAGCCTCTCCGAGTGCGGG + Intergenic
913499768 1:119461505-119461527 GGCCCAAGGACTCTAGGTGCTGG + Intergenic
915170323 1:153972943-153972965 GGCCCAGGATGTGTGAGTCCTGG - Intronic
915562840 1:156697477-156697499 AGCCCTTGGGCTCTGAGTGCGGG - Intergenic
919778411 1:201208347-201208369 GGACCAGGGTCTCTGAGGGCAGG + Exonic
920363974 1:205438437-205438459 GGCGCAGGGTCTGCGAATGCTGG + Intronic
920811217 1:209287674-209287696 GGCCCAGGTTATCTCTGTGCTGG + Intergenic
922179876 1:223225265-223225287 GACCCTGAATCTCTGAGTGCTGG + Intronic
922238463 1:223738950-223738972 GGCCCAGGGCCTATGGCTGCTGG - Intronic
922511396 1:226171118-226171140 GGCGCAGGGTCTTTGAGGGATGG + Intronic
923080438 1:230648291-230648313 AGCCCAGTGTTGCTGAGTGCCGG + Intronic
923206151 1:231760827-231760849 GGCCCAGGGGGCCTGAGTGCTGG + Intronic
1063944389 10:11162940-11162962 GGTACAGGGGCTCTGAGTTCTGG - Intronic
1066654695 10:37686966-37686988 GGGCCTGGGTCTCCTAGTGCAGG - Intergenic
1067039654 10:42942429-42942451 GGACCTGGGCCTCCGAGTGCAGG - Intergenic
1067077888 10:43198367-43198389 GGGCCAGGGCTTCTGAGTTCAGG + Intronic
1067721552 10:48731492-48731514 GGCCCAGGAGCCCTGAGTCCCGG - Exonic
1067752522 10:48981540-48981562 GCCCCAGTGGCTCTGAGTCCAGG + Intronic
1069490830 10:68859016-68859038 GGCCCCAGGTCTCTGTGGGCAGG - Intronic
1073085180 10:100883653-100883675 GGCCCAGGGTCCCTGCCAGCGGG - Intergenic
1074188809 10:111118069-111118091 AGCGCCGGGACTCTGAGTGCAGG + Intergenic
1076525871 10:131112180-131112202 AGCCCAGGGTCTCTGCTTCCAGG + Intronic
1076865325 10:133163798-133163820 GTCCCTGGGTCTCAGAGGGCAGG - Intronic
1076888458 10:133273072-133273094 GGCCCCGGGTCCCTGAGGGAGGG - Intronic
1077124502 11:926285-926307 GGTCCAGGGTCTGGGGGTGCGGG + Intronic
1077124527 11:926365-926387 GGCCCTGGGTCTGGGGGTGCGGG + Intronic
1077155475 11:1089119-1089141 AGCCCAGGGTCTCAGAGGGGAGG - Intergenic
1077194022 11:1270392-1270414 GCCCCAGAGTCTCAGAGGGCAGG - Intergenic
1077282538 11:1752220-1752242 TGCCCAGGGTCCCTGGTTGCAGG - Intronic
1077656569 11:4024949-4024971 TTCCCAGGGTCTCTTAGGGCAGG + Intronic
1078328408 11:10398736-10398758 AGCCCAGGGGCTGTGAGAGCAGG - Intronic
1078466630 11:11554874-11554896 AGCCCAGGGTCTCTGAGCAGGGG + Intronic
1079400398 11:20102292-20102314 GGCCCAGGGTGGGTGGGTGCTGG + Intronic
1081782453 11:45722573-45722595 CGCCCAGGGTCACAGAGTGAGGG - Intergenic
1083484925 11:62977221-62977243 GGCCCAGGGTCTCTGGCAGGAGG + Exonic
1083655407 11:64226838-64226860 GCGCCAGGGTGGCTGAGTGCAGG - Exonic
1083812118 11:65112020-65112042 GGCCCGGGGGCCCTGAGTGGGGG - Exonic
1084191915 11:67503376-67503398 GGGTCAGGGCCTCTGAGAGCTGG - Intronic
1084237194 11:67795934-67795956 GGACCCGTGTCTCTGTGTGCAGG + Intergenic
1084311965 11:68322246-68322268 AGCCCAGGGAGTCTGAGTGGAGG - Intronic
1084524230 11:69685983-69686005 GGCCGAGGGTCAGGGAGTGCAGG - Intergenic
1084608115 11:70184288-70184310 TGCCCAGGGTCTGTGGGGGCAGG - Intronic
1084910100 11:72381460-72381482 GGCCCAGAGTCCATGACTGCTGG - Intronic
1085479153 11:76807281-76807303 GCCCCTGGGTCTCAGCGTGCAGG + Intergenic
1085521966 11:77144349-77144371 GGACCAGGGACTCTGTCTGCAGG + Intronic
1085523132 11:77149810-77149832 TGCCCTGCCTCTCTGAGTGCAGG - Intronic
1087138201 11:94740805-94740827 GGCTCAGGGATTCTGAGCGCTGG + Intronic
1088909942 11:114183212-114183234 GGCCCAGAGTCACTGAGGACAGG + Intronic
1090018025 11:123102962-123102984 AGCCCAGGGTCTCACACTGCAGG + Intronic
1090412392 11:126518263-126518285 GGCCCAGCGGCTCTGCGAGCTGG + Intronic
1092159279 12:6307176-6307198 AGCCGAGGGTCTCTGGGTGGTGG - Intergenic
1094107736 12:26832276-26832298 AGCCCCTGGTCTCTCAGTGCCGG - Intronic
1095123080 12:38442034-38442056 GGGCCAGCGGCTCTGAGTGCAGG - Intergenic
1096412809 12:51389664-51389686 GGCTGAGGGCCTCTCAGTGCAGG - Intronic
1097154793 12:57004827-57004849 CGCACATGGTCTCTGAGAGCCGG + Exonic
1101252992 12:102953532-102953554 GGCACAGGGTCTCTGATCTCAGG + Intronic
1102035424 12:109768381-109768403 GGCCAAGGGACCCAGAGTGCTGG - Exonic
1102040959 12:109800508-109800530 GGCCCTGGGTGTCTGGGTGATGG + Intronic
1102377984 12:112439135-112439157 AGCCCAGGGTCACAGAGAGCTGG + Intronic
1102898808 12:116620185-116620207 GGCCCTGGGTCCCTGGCTGCAGG + Intergenic
1103562202 12:121798580-121798602 GGGCTAGGATCTCTCAGTGCTGG - Intronic
1104364182 12:128162053-128162075 GGCCCAGGAGCACTGAGGGCAGG - Intergenic
1104409111 12:128543462-128543484 GGCCCAGTGGCTCTGTGTGGTGG + Intronic
1104791086 12:131482569-131482591 GGCCCATCTTCTCTGAGTTCAGG - Intergenic
1104903711 12:132202698-132202720 GGCACTGGGTCCCTGAGTTCTGG - Intronic
1104943812 12:132406832-132406854 AGAGCAGGGTCTCTGAGTGTCGG - Intergenic
1104949317 12:132431938-132431960 TGCACAGGGTCACTGGGTGCTGG - Intergenic
1104961473 12:132490306-132490328 GGCCGAGGGCCGCTGAGCGCCGG + Exonic
1107042397 13:35963136-35963158 AGCCTAGCATCTCTGAGTGCCGG + Intronic
1107274122 13:38657527-38657549 GGACCAGGATCTCTGAGTAAGGG - Intergenic
1108380247 13:49847988-49848010 GGGCGAGGTTCTCTGCGTGCCGG - Intergenic
1111654132 13:91131046-91131068 GGCCAAGAATCTCTGAGAGCTGG - Intergenic
1112560120 13:100505613-100505635 GCCCCAGGTTCCCAGAGTGCTGG - Intronic
1113073121 13:106441025-106441047 GACCCAGGCTCTTTGAGTGCAGG + Intergenic
1113362553 13:109644823-109644845 GCCTCAGCCTCTCTGAGTGCTGG - Intergenic
1113564682 13:111312849-111312871 GGACCAGGTTCTCTGAGCTCGGG + Intergenic
1113913647 13:113856998-113857020 GGCCCAGGCTCTCTGAGGGCTGG + Intronic
1113922628 13:113922433-113922455 GGCCCTAGATCTCTGGGTGCAGG - Intergenic
1119400599 14:74359779-74359801 GGCCCAGAGTCTCTGCTTGTGGG + Exonic
1121013457 14:90534891-90534913 GGCCCAGACTCTCTGCCTGCAGG - Exonic
1122325898 14:100880494-100880516 GGCGCTGGGTCTCTGAGGACTGG + Intergenic
1122428977 14:101628056-101628078 GGGCCTGGGTCTCCGAGTGTGGG + Intergenic
1122463767 14:101916869-101916891 TGCTCAGGGCCTCTGAGTTCAGG - Intronic
1122913066 14:104843244-104843266 GGCCCAGGCTCTTTGACTGATGG + Intergenic
1122924756 14:104894461-104894483 TGCCCCGGGGCTCTGTGTGCAGG - Intronic
1123110894 14:105866429-105866451 GGCACAGGGTGTCTGGGGGCAGG + Intergenic
1123491665 15:20786129-20786151 GCCTGGGGGTCTCTGAGTGCAGG - Intergenic
1123548167 15:21355223-21355245 GCCTGGGGGTCTCTGAGTGCAGG - Intergenic
1124074946 15:26435555-26435577 GGCCCAGGGGCTTTGAGTTGGGG - Intergenic
1124626477 15:31310342-31310364 GGCCTAGGGTCGCTGAGAGTGGG + Intergenic
1124673324 15:31660447-31660469 AGCCCAGTGTCTTTCAGTGCGGG + Intronic
1125202661 15:37113682-37113704 TTCCCAGGGTCCCTGAGGGCTGG + Intergenic
1127060887 15:55182922-55182944 GGCCCAGGCTCTTTGAGTCTGGG - Intronic
1128378694 15:67095326-67095348 GACCCAGGGCCTCAGAGTGTGGG + Intronic
1128877677 15:71215355-71215377 GGCCCTGGGGCTGTGGGTGCCGG - Exonic
1129850276 15:78789792-78789814 GTCCCAGGGTCTCACAGGGCCGG + Exonic
1130904211 15:88228476-88228498 CTCCCAGAGGCTCTGAGTGCAGG - Intronic
1132055587 15:98648711-98648733 GGCCGAGGGTCTGCGAGCGCCGG - Intergenic
1202956499 15_KI270727v1_random:82453-82475 GCCTGGGGGTCTCTGAGTGCAGG - Intergenic
1132671591 16:1104183-1104205 GGCCCGGGGTCTCTGGGCTCAGG + Intergenic
1132836842 16:1958478-1958500 CGGCCAGGCTCTCCGAGTGCGGG + Intergenic
1133141045 16:3744306-3744328 GGCCCAGGGTTAGAGAGTGCTGG + Intronic
1133755710 16:8761120-8761142 GGCCCAGGGATTCTGATTTCAGG + Intronic
1135237948 16:20775999-20776021 TGCCCAGGGTCCCAGAGTGGTGG + Exonic
1136003942 16:27315538-27315560 AGCTCAGGGTCCCTGGGTGCTGG - Intronic
1139668573 16:68475501-68475523 GTCCCAGGTTCTTTGAGAGCAGG - Intergenic
1140095211 16:71869339-71869361 TGCCCAAGGTCTAGGAGTGCAGG - Intronic
1140924050 16:79565999-79566021 GGCCCAGGGTCTATCAGTGCAGG - Intergenic
1141498982 16:84430694-84430716 GGACCAGGGTCTTTTGGTGCTGG + Intronic
1141698853 16:85633284-85633306 CGCACAGGGTCCCTGAGTGGCGG + Intronic
1141766793 16:86064253-86064275 GTCCCAGGGACCCTGACTGCAGG + Intergenic
1142068917 16:88078647-88078669 GGCACAGCTCCTCTGAGTGCTGG - Intronic
1142148675 16:88503230-88503252 GGCCCACGGTTCCTGAGTGGAGG + Intronic
1142148687 16:88503268-88503290 GGCCCACGGTTCCTGAGTGGAGG + Intronic
1142148700 16:88503309-88503331 GGCCCACGGTTCCTGAGTGGAGG + Intronic
1142148712 16:88503347-88503369 GGCCCACGGTTCCTGAGTGGAGG + Intronic
1142148723 16:88503384-88503406 GGGCCACGGTTCCTGAGTGCAGG + Intronic
1142148747 16:88503460-88503482 GGCCCACGGTTCCTGAGTGGAGG + Intronic
1142210996 16:88808428-88808450 GCCCGAGGGTCTCTGGCTGCGGG + Exonic
1142376437 16:89709266-89709288 GGCCCAGGAGCTCGGACTGCTGG - Exonic
1143507974 17:7380044-7380066 GGCTCTGGGTCTCTGGGTACTGG + Intergenic
1144811080 17:17999315-17999337 GGCCCAGGGACTCCGCATGCAGG - Intronic
1144892311 17:18501062-18501084 GGCCCGGGGTGTCTGAGGACTGG - Intergenic
1145139903 17:20443226-20443248 GGCCCGGGGTGTCTGAGGACTGG + Intergenic
1146662740 17:34675378-34675400 AGCCCAGGTTCACTGAGGGCTGG + Intergenic
1147673601 17:42190690-42190712 GGCCCAGGGCCTCAGAGAACAGG + Exonic
1148047543 17:44753375-44753397 GGCACAGGTTCTCTCTGTGCTGG + Intergenic
1149654148 17:58301585-58301607 GCCCCAGGGTCTTTGGGGGCGGG + Intronic
1149903324 17:60502174-60502196 GCCTCAGACTCTCTGAGTGCTGG + Intronic
1150631927 17:66885873-66885895 GGCCCAGGGCAGCTGAGTTCTGG - Intergenic
1151732630 17:75920405-75920427 GGGCCAGGGACTCTGGGAGCAGG + Exonic
1152487677 17:80605140-80605162 GCCCCAGGGCATCTGAGTGCTGG - Intronic
1152553384 17:81040851-81040873 GGCCCAGGGGCTCTTGGTGTTGG + Intronic
1152694666 17:81738156-81738178 GGCCTCGGGTCCCTGACTGCTGG - Intergenic
1154022469 18:10676566-10676588 GCCCCTGGGTCTCTGAATGGGGG - Intronic
1154377460 18:13822070-13822092 GGCCCAGGGGCCCTATGTGCAGG - Intergenic
1154437283 18:14356896-14356918 GGTCCAGGGTCCCTGGGTGGGGG + Intergenic
1156298081 18:35810625-35810647 AGCACAGGGTCTCTGAGTCCAGG + Intergenic
1156337912 18:36186705-36186727 GTCCCAGGTGCTCTGGGTGCAGG + Intergenic
1157311891 18:46559228-46559250 GGCCCATGGGCTCTAGGTGCTGG + Exonic
1157480125 18:48048458-48048480 AGCCCAGGCTATCTGAGAGCGGG - Intronic
1160426259 18:78781269-78781291 GGCCCAGGTGCCCTCAGTGCCGG + Intergenic
1160566414 18:79788855-79788877 GGCTCGGGGTCTCTGGGTTCTGG + Intergenic
1160749445 19:727105-727127 GACCCAGGGTCAGGGAGTGCAGG + Intronic
1160905479 19:1449957-1449979 GGCTCAGGGGCCGTGAGTGCGGG - Intronic
1161021865 19:2014709-2014731 GGCCCAGGGGCTCCAAGTGCAGG + Intronic
1161609878 19:5236640-5236662 AGCCCAGTGTCTCTGAGGACAGG - Intronic
1161895414 19:7075850-7075872 ATCCCAGGGTCTCTGAGTGAGGG + Intronic
1162120318 19:8461980-8462002 AGCTCAGGGCCCCTGAGTGCGGG + Intronic
1163214420 19:15865084-15865106 GGACCTGGGTCTCTGAGCTCAGG + Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164582554 19:29443291-29443313 GCTCCAGGGGCTCAGAGTGCGGG + Intergenic
1165067080 19:33235671-33235693 GCCCCAGGGACTGTGGGTGCTGG + Intergenic
1165116774 19:33533436-33533458 GCCTCAGGGTCTCTGGGAGCAGG - Intergenic
1167609653 19:50500993-50501015 GGCCCAGGGGCACTGAGAGAAGG + Intergenic
1168412470 19:56148296-56148318 GGCACAGGGGCCCTGAGTGAGGG + Intronic
925050096 2:806834-806856 GGCCCAGGGCCTCTGAGCCATGG + Intergenic
925354949 2:3234090-3234112 GGCCCAGGGCCACAGAGTGAGGG + Intronic
925373141 2:3362080-3362102 TGCCCAGGGGCGCTTAGTGCGGG - Intronic
925594156 2:5538934-5538956 GAACCAGGGCATCTGAGTGCCGG + Intergenic
926829327 2:16943484-16943506 GGCCCAGGGTCTGTCAGACCTGG - Intergenic
926953705 2:18271673-18271695 GGCTGAGGGTAGCTGAGTGCTGG - Intronic
928364686 2:30691892-30691914 GCCCCAAGGCCTCTGAGTGGGGG - Intergenic
928881062 2:36097170-36097192 GGACCAGGGTTTCTGGCTGCAGG - Intergenic
931243071 2:60469574-60469596 GGGTCAGGGTTTCTGGGTGCTGG - Intronic
932252795 2:70258781-70258803 AGCCAAGGGCCTCTGAGAGCAGG - Intronic
932666464 2:73702401-73702423 GGCCAATGGTGACTGAGTGCAGG - Intergenic
932941397 2:76171070-76171092 AGTCCAGGTTCTCTGAGTGATGG + Intergenic
933026517 2:77266696-77266718 GGCCCAGTGTTTCTGACTGCAGG + Intronic
934775945 2:96937518-96937540 AGCCCAGGGGCTCTCAGTTCTGG + Intronic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
935814526 2:106834930-106834952 TGCCCAAGTTCTCTGAATGCTGG + Intronic
936528695 2:113259885-113259907 GGTCCAGGGTCTCTGCGTTTGGG + Intronic
937128245 2:119488103-119488125 GGCCCAAGGACTCTGCCTGCTGG - Intronic
937288557 2:120768207-120768229 GGCACAGGGGCTCTGAGCACAGG - Intronic
940854015 2:158715918-158715940 GGCCCAGGGTCCTGGAGGGCAGG - Intergenic
942125262 2:172818489-172818511 GACCCAGGGTCTCTGATTCAGGG - Intronic
946282006 2:218672398-218672420 GGGCCAGGGGGTCTGAGAGCGGG + Exonic
946878022 2:224149861-224149883 TGCCCAGGGCCTCTGAGCCCGGG + Intergenic
947748436 2:232521153-232521175 GGAGCACGGGCTCTGAGTGCTGG + Intronic
947750796 2:232530890-232530912 GGGCTGGGGTCTCTGAGTGAGGG + Intronic
948431598 2:237922553-237922575 TGCCCAGTGTCCCTGAGCGCGGG + Intergenic
948550056 2:238765262-238765284 GGCCCAGGGTATGGGAGTGAGGG - Intergenic
949028156 2:241775840-241775862 AGCCCAGGGTCTCTGATGCCAGG + Intergenic
1170178508 20:13500104-13500126 GGTCCAGGGTGTGTGTGTGCAGG - Intronic
1173580779 20:44145070-44145092 GCCCCAGGGTCAGTGAGTTCAGG - Intronic
1173933712 20:46843417-46843439 GGCCCAGGGTCACAGTTTGCAGG + Intergenic
1174056632 20:47802711-47802733 GGCCCAGGGCATCTGATTCCAGG - Intergenic
1175461832 20:59157589-59157611 GGGCCAGGGTCTCTCAGACCAGG + Intergenic
1175491438 20:59383409-59383431 AGCCCAGGCACCCTGAGTGCTGG - Intergenic
1175920702 20:62449375-62449397 GGCCCAAGGATTCTGGGTGCCGG - Intergenic
1176516533 21:7788593-7788615 GCCTCAGGGTCTCTAAATGCTGG + Intergenic
1176710541 21:10146202-10146224 GGCCCAGGGTCTCATGGGGCAGG + Intergenic
1178650561 21:34418605-34418627 GCCTCAGGGTCTCTAAATGCTGG + Intergenic
1179724063 21:43331986-43332008 GGCCCAGGAGCTCTAAGTTCAGG + Intergenic
1180050884 21:45330570-45330592 GGACCAGGGCCTCAGAGTGGAGG + Intergenic
1180050898 21:45330601-45330623 GGCCCAGGGCCTCAGGGTGGAGG + Intergenic
1180050918 21:45330660-45330682 GGCCCAGGGCCTCAGGGTGAAGG + Intergenic
1180732918 22:17995429-17995451 GGCCCAGCCTCTCAAAGTGCTGG + Intronic
1181000306 22:19985055-19985077 GGGCCAGGGTCCCTGAGAGTGGG - Intronic
1181855991 22:25781919-25781941 GTCCCACGGCCTCTCAGTGCTGG - Intronic
1182014969 22:27032045-27032067 GGCTCAGCTTCTGTGAGTGCCGG - Intergenic
1182309339 22:29393598-29393620 GGCCTGGGGTCTCAGAGGGCCGG - Intronic
1182584967 22:31339722-31339744 GGCCCAGGCACCCTGAGTGCAGG + Intronic
1183241493 22:36661036-36661058 GGCACATGCTTTCTGAGTGCAGG + Intronic
1183334656 22:37239756-37239778 GTCCCTGGGTCTCTGGATGCTGG - Intronic
1184782652 22:46656917-46656939 GGCCCATGGTGGCTGAGGGCTGG - Intronic
1185065740 22:48630951-48630973 GGCCCAGGGTCACCGAGGACAGG + Intronic
1185080602 22:48707563-48707585 GGCCCAGTGTCCCTGTGTGAGGG + Intronic
1185146935 22:49142504-49142526 GTCTCCGGGTCTGTGAGTGCAGG + Intergenic
1185217448 22:49609582-49609604 GGAACAGGGTCTCTGAGGGGTGG + Intronic
1185409097 22:50673441-50673463 GGCACAGGGGCTCGCAGTGCAGG + Intergenic
950431933 3:12955760-12955782 GGCCGAGGGTCCCTGAGGGATGG - Intronic
950438156 3:12992999-12993021 GGGCCAGGGTCTTAGAGTGTGGG - Intronic
950741101 3:15052418-15052440 GGCCCACGGTCACTGTGGGCTGG - Exonic
950773837 3:15332907-15332929 GGGCCAGGGTCACTGAGCGTAGG - Intronic
951587989 3:24234834-24234856 AGCCCAGGGTATGTGACTGCAGG + Intronic
952236689 3:31487294-31487316 GGGCCAGGGTTTGGGAGTGCAGG - Intergenic
952733189 3:36661394-36661416 TGTCCAGGGTCTCTAAGTTCAGG + Intergenic
954419186 3:50409671-50409693 GGCCACGGCTCTCTGAGGGCAGG + Intronic
954580958 3:51702717-51702739 GGCTCAGGCTCGCTGTGTGCAGG - Intronic
955542240 3:59989519-59989541 GGCACAGGGTCTCTGAGGGCTGG + Intronic
959991729 3:112638739-112638761 GGTCCAGGGCCTCTGCGTGGTGG + Exonic
960057644 3:113286603-113286625 GGCCCAGTGTCACTGGGTGTTGG + Intronic
960581105 3:119279550-119279572 CCCCCAGGGTCTCTGAATACTGG - Intergenic
961548546 3:127652913-127652935 TGCCCTGGGTCACTGAGGGCAGG + Intronic
962605633 3:137030650-137030672 GGCCCAGGGTAGCAGAGTGGAGG + Intergenic
963607900 3:147427988-147428010 GGCTTAGGCTCTGTGAGTGCCGG + Intronic
965471530 3:169098775-169098797 GCCCCAGCCTGTCTGAGTGCTGG + Intronic
966912011 3:184564995-184565017 GGCCCAGGGTCCCTGAGCCCTGG + Intronic
968597698 4:1493741-1493763 GCCCCGAGGTCCCTGAGTGCAGG - Intergenic
968815250 4:2818453-2818475 GGTCCAGGGGCTCGGGGTGCGGG - Intronic
968975517 4:3820356-3820378 GGCCCAGGACCTCCCAGTGCTGG - Intergenic
969174743 4:5389966-5389988 TGCCCAGGTTCCCTGACTGCTGG - Intronic
969530841 4:7729387-7729409 GGCCCTGGGTAGCTGGGTGCAGG + Intronic
971215957 4:24662276-24662298 TGCCCAGGGTCTGTGTGTGTGGG - Intergenic
973826118 4:54708995-54709017 GGCCCAGAGTGTCTGTGTGAGGG + Intronic
979275740 4:118812613-118812635 GACCCAGGGCCACTGAGTGGTGG + Intronic
985099959 4:186448962-186448984 GGCCCAGAGTCCCTGATTTCTGG + Intronic
985503526 5:264407-264429 GGCACAGGGTGTCTGGGAGCCGG + Intergenic
985525458 5:399173-399195 GCCCCAGGGTCTCTGAGGCCGGG + Intronic
985551888 5:537931-537953 GGCCCAGGGCCAGTGAGTGTGGG + Intergenic
985720313 5:1485425-1485447 AGCCCAGGGCTTCTGAATGCAGG + Intronic
985724507 5:1508811-1508833 GGCCCAGGCTCTCTGATTTCAGG + Intronic
986273712 5:6255751-6255773 GGCCCAGGGCCTCTGTGAGAGGG - Intergenic
986336629 5:6760256-6760278 GGCCCAGGCTCTCTGCTGGCAGG - Intergenic
988922294 5:35954423-35954445 GGCTCAGGGGCTGAGAGTGCAGG + Exonic
992894530 5:81234818-81234840 GGCCCAGGGCCTCTGAGCTAGGG - Intronic
993899556 5:93575048-93575070 AGCCCAGGGTCTCTGCGATCTGG + Intergenic
994274702 5:97821998-97822020 CTCCCAGGGTCTCTGAGTCCAGG - Intergenic
995517809 5:112971690-112971712 GGCCCTGGGTAAATGAGTGCTGG + Intergenic
997129774 5:131264559-131264581 GGCCCGGGGTCTCTAGGTGAGGG + Intronic
997197335 5:131988835-131988857 GGCCCAGGGTGTCATAGAGCGGG + Exonic
997580951 5:135016675-135016697 GGCCCAGTGAGTCTGAGTGCTGG - Intergenic
997593994 5:135094321-135094343 GGCCTGGGCTTTCTGAGTGCTGG - Intronic
997995712 5:138584362-138584384 GGACCTAGGTATCTGAGTGCTGG + Intergenic
999106452 5:149075306-149075328 GGCCCAGGGTGTGTAAGTCCAGG - Intergenic
999221777 5:149985782-149985804 GGCCCAGGGTCCTAGACTGCTGG - Exonic
1001579535 5:172789447-172789469 GGCTCAGGGTCCCTTGGTGCTGG + Intergenic
1001653679 5:173332076-173332098 GGTCCAGGCTTTCTGAGTTCCGG + Intergenic
1002666797 5:180831267-180831289 GCCCCAGGGCCTCTGAGCTCCGG + Intergenic
1003383738 6:5648542-5648564 GACCCAGGGTCTCTAGGTGAGGG + Intronic
1003385265 6:5661542-5661564 GAGCCAGGGTGTGTGAGTGCTGG + Intronic
1006407206 6:33852228-33852250 GCCCCAGGGCCTCTGCCTGCCGG + Intergenic
1006456386 6:34134388-34134410 GTTCCTGGGTCTCTGAGTCCCGG - Intronic
1006578677 6:35064125-35064147 GTCCCAAGGTCTCTGAGCCCTGG + Intronic
1006776633 6:36597942-36597964 GCCTCAGCCTCTCTGAGTGCTGG + Intronic
1013512751 6:110859251-110859273 AACCCAGGGTCTGTGAGTGGCGG + Intronic
1015585541 6:134772565-134772587 GGCCCAGGGCCTGTGAGTAGTGG - Intergenic
1015700872 6:136034811-136034833 GGCCCAGGGTCCCTGAGGGGTGG - Intronic
1019475042 7:1240406-1240428 CGGCCAGGGTCTAGGAGTGCGGG + Intergenic
1019475058 7:1240448-1240470 TGGCCAGGGTCTAGGAGTGCGGG + Intergenic
1019661033 7:2224147-2224169 GGCCGAGAGTCCCTGAGGGCAGG - Intronic
1020040271 7:4996300-4996322 GGCCCAGGGGTGCTGAGTGCTGG + Intronic
1021520713 7:21536812-21536834 GGGCCAGCCGCTCTGAGTGCGGG + Intergenic
1021774517 7:24039297-24039319 GGCCCAAGGTCTTTGTGTCCTGG - Intergenic
1022009055 7:26292837-26292859 GGCCGAGGGACGCTGAGTGTTGG + Intronic
1024992817 7:55249731-55249753 GGTCCAGGCTCTTTGACTGCAGG - Intronic
1025236372 7:57237471-57237493 GGCCCAGGGAGTCTGATTCCTGG + Intergenic
1025635983 7:63319068-63319090 AGATCAGGGTCCCTGAGTGCTGG - Intergenic
1025646713 7:63429112-63429134 AGATCAGGGTCCCTGAGTGCTGG + Intergenic
1026468735 7:70676499-70676521 GGCCCAGGGAGTCTGAGGGGTGG + Intronic
1026501604 7:70947508-70947530 GGCCCAGGGACTCTCAGGCCCGG - Intergenic
1026848705 7:73711833-73711855 TGCCAGGGGTCTCTGAGGGCAGG - Intronic
1026963733 7:74426115-74426137 GGGCCATGGTCCCTGAGGGCTGG - Intergenic
1028168279 7:87564455-87564477 GGCCCAGTGTCTCTGGGCGCTGG + Intronic
1029145569 7:98443459-98443481 GCCCCAGGGTCTGTGGCTGCAGG + Intergenic
1030524924 7:110641330-110641352 GGCCTAGGGCCCCAGAGTGCTGG + Intergenic
1031111898 7:117620855-117620877 GCCCCAGGCTCTCAAAGTGCTGG - Intronic
1032601750 7:133304372-133304394 GGCCCAGGGGCTCTCATAGCAGG + Intronic
1033658289 7:143387663-143387685 GGGACAGGGTCTCTGTGTGGGGG + Intronic
1034413929 7:150955314-150955336 GGCCCAAGGGCTCTGACTCCAGG - Intronic
1034470106 7:151250340-151250362 GGCCCAGGCTCTGTGTGTGGGGG - Intronic
1034670398 7:152853342-152853364 GGCGGAGAGTCACTGAGTGCTGG + Intronic
1035313673 7:157984901-157984923 GGCCCAGGCTCTCTGTGTAGAGG + Intronic
1036701703 8:11017568-11017590 GGCCCAGGGTCTCTGAGTGCCGG - Intronic
1038068344 8:23986398-23986420 GACTCAGGGCCTCTGAGTCCTGG + Intergenic
1038466200 8:27766138-27766160 GGCCCAGTGTCTATGAATTCAGG - Intronic
1039093387 8:33856892-33856914 GGCTCAGGCTCTCAAAGTGCTGG + Intergenic
1040026535 8:42786857-42786879 GGCCCAGGTGCTCCGAGTGCGGG - Intronic
1040578784 8:48677821-48677843 GGCCCAGGGTCTCAGAGTCTTGG + Intergenic
1042356576 8:67835018-67835040 GGCACACGGTCTCTGTGTGCAGG - Intergenic
1042948774 8:74179794-74179816 GGGCCAGCGGCTCCGAGTGCGGG + Intergenic
1044204328 8:89474599-89474621 GGCCCAGGGTGTCTGTCTGCTGG + Intergenic
1044728258 8:95210066-95210088 GACACAGGGTCACTGAGTGGAGG + Intergenic
1044861468 8:96527571-96527593 GTCCCAGGGCCTCTTCGTGCAGG + Intronic
1046239706 8:111475069-111475091 CGTCCTGGGTCTCTCAGTGCTGG - Intergenic
1047965319 8:130042143-130042165 GACTCAGAGTCTCTGAGAGCGGG + Intergenic
1048874943 8:138829224-138829246 GGCCCAGGTGCTATGAGTGATGG - Intronic
1048963381 8:139597922-139597944 GCCCCAGGGTCTGTGAGGCCAGG - Intergenic
1048981579 8:139705506-139705528 GGCCCGGGGTCCCTGAGGCCAGG - Intergenic
1049487631 8:142874810-142874832 GGCCCAGGTTCTCCCAGTACCGG + Intronic
1049616768 8:143578929-143578951 GGCCCAGTGTCCCTCAGTGGTGG + Intergenic
1052704702 9:31981277-31981299 GGCCCAGGGTCTATGAGGCCAGG + Intergenic
1053271438 9:36752253-36752275 GGCCCAGGAGCTCTGTGTCCTGG + Intergenic
1053466940 9:38315699-38315721 TGGCCAGGGAATCTGAGTGCTGG - Intergenic
1053618390 9:39792509-39792531 GGCCCAGGATGACTGAGTGCCGG - Intergenic
1053876565 9:42551867-42551889 GGCCCAGGATGACTGAGTGCCGG - Intergenic
1053896110 9:42742836-42742858 GGCCCAGGATGACTGAGTGCCGG + Intergenic
1054235133 9:62549854-62549876 GGCCCAGGATGACTGAGTGCCGG + Intergenic
1054265766 9:62914920-62914942 GGCCCAGGATGACTGAGTGCCGG + Intergenic
1055757264 9:79570792-79570814 GGTCCAGCGTCTCTGATTCCCGG + Intergenic
1055925602 9:81507456-81507478 TGGCCAGAGGCTCTGAGTGCGGG - Intergenic
1056799422 9:89681177-89681199 GGGCCAGCCACTCTGAGTGCGGG - Intergenic
1056810146 9:89757710-89757732 GGCCGTGGATCTCTGAGTGATGG - Intergenic
1056988960 9:91391825-91391847 GGGCCAGGCTCTCTGAATCCTGG + Intergenic
1057865123 9:98674429-98674451 GGTCTAGGGGCCCTGAGTGCTGG + Intronic
1057902705 9:98961916-98961938 GGACCAGGGGCTCTTTGTGCTGG - Intronic
1057903895 9:98969677-98969699 GGCCCAAGGTCACTGAGGGCTGG + Intronic
1057913772 9:99040253-99040275 GGCCCAGGGACTGTGAGGACAGG - Intronic
1058383978 9:104410924-104410946 GGCCTAGGGTTTTTGTGTGCTGG - Intergenic
1060062837 9:120476275-120476297 GGCCCTGGCTCTCTGATTGTTGG - Intronic
1060835981 9:126755495-126755517 GGCCCTGGGCCTCTGAGGGAAGG + Intergenic
1061168830 9:128940394-128940416 GGCCCAGGGGCTCCGTGTACAGG - Exonic
1061235803 9:129341958-129341980 GGCTCAGGGTCTCTGGGTAGGGG - Intergenic
1062195164 9:135269009-135269031 GGCACAGGCTCTCTTAGTGAGGG - Intergenic
1062204153 9:135326455-135326477 TGTCCAGGGTCTCTGTGTCCAGG - Intergenic
1062264612 9:135681308-135681330 GGCACAGGGGCCCTGAGAGCTGG + Intergenic
1062382075 9:136291326-136291348 GGCCCAGGGACTCTTAGAGAAGG + Exonic
1062422022 9:136487255-136487277 GGCTGAGGGTCTCTGACTTCTGG - Intergenic
1062610568 9:137371613-137371635 GGACCAGTGCCCCTGAGTGCCGG + Intronic
1062617253 9:137403450-137403472 GGCCCAGGGTCTCCGAGGGTCGG + Intronic
1202795302 9_KI270719v1_random:115197-115219 GGCCCAGGGTCTCATGGGGCAGG + Intergenic
1203363214 Un_KI270442v1:235836-235858 GACCCAGCGTCTCAAAGTGCTGG - Intergenic
1186205094 X:7192160-7192182 GCCCCAGGGTCTCTGACTTTGGG - Intergenic
1192793961 X:74411485-74411507 GGGCCAGGGTCTGAGAATGCAGG + Intergenic
1192806212 X:74511713-74511735 GGCTTAGAGTGTCTGAGTGCTGG + Intronic
1199974959 X:152888994-152889016 GCCCCAGGGGCTCTGAGAGTGGG - Intergenic
1200749189 Y:6929285-6929307 GGCCAAGGGTAGCTCAGTGCAGG - Intronic
1201773726 Y:17642914-17642936 GTCCCAGAGTCTCAGAGTGCTGG + Intergenic
1201827830 Y:18263071-18263093 GTCCCAGAGTCTCAGAGTGCTGG - Intergenic