ID: 1036706769

View in Genome Browser
Species Human (GRCh38)
Location 8:11052483-11052505
Sequence TCTGGCATGCAGATGGCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036706758_1036706769 18 Left 1036706758 8:11052442-11052464 CCAGTTCCCTGTGGAATCTCCCG 0: 1
1: 0
2: 0
3: 15
4: 114
Right 1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG No data
1036706764_1036706769 -1 Left 1036706764 8:11052461-11052483 CCCGGACCGACACTGGCTGGCAT 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG No data
1036706765_1036706769 -2 Left 1036706765 8:11052462-11052484 CCGGACCGACACTGGCTGGCATC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG No data
1036706760_1036706769 12 Left 1036706760 8:11052448-11052470 CCCTGTGGAATCTCCCGGACCGA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG No data
1036706767_1036706769 -7 Left 1036706767 8:11052467-11052489 CCGACACTGGCTGGCATCTGGCA 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG No data
1036706761_1036706769 11 Left 1036706761 8:11052449-11052471 CCTGTGGAATCTCCCGGACCGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1036706769 8:11052483-11052505 TCTGGCATGCAGATGGCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036706769 Original CRISPR TCTGGCATGCAGATGGCGCG AGG Intronic
No off target data available for this crispr