ID: 1036708021

View in Genome Browser
Species Human (GRCh38)
Location 8:11059587-11059609
Sequence GGTGCCAGTGGAGGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036708008_1036708021 26 Left 1036708008 8:11059538-11059560 CCCGGCCCGGCGAGCGACAAGAG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG No data
1036708010_1036708021 21 Left 1036708010 8:11059543-11059565 CCCGGCGAGCGACAAGAGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG No data
1036708009_1036708021 25 Left 1036708009 8:11059539-11059561 CCGGCCCGGCGAGCGACAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG No data
1036708016_1036708021 -4 Left 1036708016 8:11059568-11059590 CCTCTTCCAGGCGCGCGGCGGTG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG No data
1036708012_1036708021 20 Left 1036708012 8:11059544-11059566 CCGGCGAGCGACAAGAGCTCGGC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG No data
1036708017_1036708021 -10 Left 1036708017 8:11059574-11059596 CCAGGCGCGCGGCGGTGCCAGTG 0: 1
1: 0
2: 0
3: 7
4: 135
Right 1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036708021 Original CRISPR GGTGCCAGTGGAGGAGGAGC AGG Intronic
No off target data available for this crispr