ID: 1036708514

View in Genome Browser
Species Human (GRCh38)
Location 8:11062201-11062223
Sequence GGTCCACTTCCCCCAGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036708514_1036708518 18 Left 1036708514 8:11062201-11062223 CCAGGCGCTGGGGGAAGTGGACC No data
Right 1036708518 8:11062242-11062264 TATCACATGCCAAGAGGCCTGGG No data
1036708514_1036708519 26 Left 1036708514 8:11062201-11062223 CCAGGCGCTGGGGGAAGTGGACC No data
Right 1036708519 8:11062250-11062272 GCCAAGAGGCCTGGGAGCCAAGG No data
1036708514_1036708517 17 Left 1036708514 8:11062201-11062223 CCAGGCGCTGGGGGAAGTGGACC No data
Right 1036708517 8:11062241-11062263 CTATCACATGCCAAGAGGCCTGG No data
1036708514_1036708516 12 Left 1036708514 8:11062201-11062223 CCAGGCGCTGGGGGAAGTGGACC No data
Right 1036708516 8:11062236-11062258 ACAAACTATCACATGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036708514 Original CRISPR GGTCCACTTCCCCCAGCGCC TGG (reversed) Intronic