ID: 1036717465

View in Genome Browser
Species Human (GRCh38)
Location 8:11139564-11139586
Sequence CTCGGAAAACAGATGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036717458_1036717465 9 Left 1036717458 8:11139532-11139554 CCGAGGGACTAGATGAGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1036717465 8:11139564-11139586 CTCGGAAAACAGATGCTCCAGGG No data
1036717461_1036717465 -8 Left 1036717461 8:11139549-11139571 CCTCACCTCCTGGAACTCGGAAA 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1036717465 8:11139564-11139586 CTCGGAAAACAGATGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036717465 Original CRISPR CTCGGAAAACAGATGCTCCA GGG Intronic
No off target data available for this crispr