ID: 1036723729

View in Genome Browser
Species Human (GRCh38)
Location 8:11201069-11201091
Sequence CCGCAGCGCCGCCGCCGACG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 213}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036723729_1036723739 11 Left 1036723729 8:11201069-11201091 CCCCGTCGGCGGCGGCGCTGCGG 0: 1
1: 0
2: 5
3: 32
4: 213
Right 1036723739 8:11201103-11201125 GCCCAGGAGGGAGCGCAGGCAGG 0: 1
1: 1
2: 5
3: 81
4: 642
1036723729_1036723734 -5 Left 1036723729 8:11201069-11201091 CCCCGTCGGCGGCGGCGCTGCGG 0: 1
1: 0
2: 5
3: 32
4: 213
Right 1036723734 8:11201087-11201109 TGCGGCGCGGCTTCCTGCCCAGG 0: 1
1: 0
2: 2
3: 12
4: 151
1036723729_1036723736 -1 Left 1036723729 8:11201069-11201091 CCCCGTCGGCGGCGGCGCTGCGG 0: 1
1: 0
2: 5
3: 32
4: 213
Right 1036723736 8:11201091-11201113 GCGCGGCTTCCTGCCCAGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 157
1036723729_1036723742 14 Left 1036723729 8:11201069-11201091 CCCCGTCGGCGGCGGCGCTGCGG 0: 1
1: 0
2: 5
3: 32
4: 213
Right 1036723742 8:11201106-11201128 CAGGAGGGAGCGCAGGCAGGCGG 0: 1
1: 1
2: 5
3: 131
4: 985
1036723729_1036723743 19 Left 1036723729 8:11201069-11201091 CCCCGTCGGCGGCGGCGCTGCGG 0: 1
1: 0
2: 5
3: 32
4: 213
Right 1036723743 8:11201111-11201133 GGGAGCGCAGGCAGGCGGAGCGG 0: 1
1: 0
2: 1
3: 54
4: 671
1036723729_1036723735 -2 Left 1036723729 8:11201069-11201091 CCCCGTCGGCGGCGGCGCTGCGG 0: 1
1: 0
2: 5
3: 32
4: 213
Right 1036723735 8:11201090-11201112 GGCGCGGCTTCCTGCCCAGGAGG 0: 1
1: 1
2: 0
3: 9
4: 185
1036723729_1036723737 7 Left 1036723729 8:11201069-11201091 CCCCGTCGGCGGCGGCGCTGCGG 0: 1
1: 0
2: 5
3: 32
4: 213
Right 1036723737 8:11201099-11201121 TCCTGCCCAGGAGGGAGCGCAGG 0: 1
1: 0
2: 5
3: 33
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036723729 Original CRISPR CCGCAGCGCCGCCGCCGACG GGG (reversed) Exonic
900205015 1:1427937-1427959 CCGCAGCCCCGCCCCCGCCACGG + Intergenic
900364806 1:2306781-2306803 CCGCAGCGCCGCCGACAACGCGG + Exonic
900393545 1:2443989-2444011 CCGCTGCGCCGCTGCCAACCGGG + Intronic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
900786924 1:4655221-4655243 CCGGCGCGCCGCCGCCGTTGGGG - Exonic
900951004 1:5858331-5858353 CGGCATCGCCGCCCCCCACGAGG + Intergenic
903514737 1:23902841-23902863 CAGCAACGCCGGCGCCGCCGTGG - Intronic
903925125 1:26826605-26826627 CCGCAGCGCCCCCTCCGCCTGGG - Intergenic
904252951 1:29237747-29237769 CCGCAGCCCCGGCGCCGCCTCGG - Intronic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904699852 1:32351724-32351746 CCGCAGCGCCGCCACCCTCCGGG - Intronic
905548576 1:38818392-38818414 CCGCCGCGCAGCCGCGGACCCGG - Intergenic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
908380575 1:63593713-63593735 TCGCATCGCTGCCGCCAACGGGG + Intronic
912069853 1:105795966-105795988 CCGCAGAGCCGGCGCCCACCTGG - Intergenic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
921945702 1:220884599-220884621 CCGAGGCGCCGCCGCCGCCAAGG - Exonic
922602909 1:226870686-226870708 CCTCAGCGCCGCAGGCGACAGGG - Intronic
1062759937 10:10733-10755 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1062759944 10:10762-10784 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997554 10:91162972-91162994 CCGCCCCGCCCCCGCCGGCGCGG + Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1071997723 10:91163510-91163532 CAGCGGCGCCTCCGCCGAGGAGG + Intronic
1072706903 10:97687378-97687400 CCGCCGCTCCGCCGCCGATTAGG - Intergenic
1073147648 10:101291484-101291506 CCCCAAGGCCGCGGCCGACGCGG - Intergenic
1074772410 10:116742536-116742558 CCCGAGCGCCGCCGCGGACGCGG - Exonic
1074819503 10:117167933-117167955 GCGCAGCGAGGACGCCGACGGGG - Intergenic
1075031947 10:119029758-119029780 CCGCCTCCCCGCCGCCGGCGCGG - Exonic
1076792506 10:132784794-132784816 CCGGAGCGACGGCTCCGACGGGG + Exonic
1076880462 10:133237106-133237128 CACCAGTCCCGCCGCCGACGCGG + Intergenic
1077385930 11:2269498-2269520 TCGCGGCTCAGCCGCCGACGAGG - Intronic
1077479540 11:2807229-2807251 CCGCAGCGACGCCTCGAACGTGG + Intronic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080540095 11:33257304-33257326 CCGCAGCGCCACCGCCCGCCCGG - Intronic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083922315 11:65787507-65787529 CCGCAGCCTCGACGCCGCCGCGG - Intronic
1085043969 11:73342943-73342965 CAGCAGCGCCGCCGGCGGCCGGG + Intronic
1089563237 11:119356481-119356503 CCGCAGCGCCCGCGCCTCCGAGG - Exonic
1090699272 11:129279512-129279534 CCGCAGCGCCCCCGCCCAGCTGG + Intergenic
1090709524 11:129373197-129373219 CCGCAGCGCCGACTACGAGGCGG - Intergenic
1091335338 11:134762206-134762228 CAGCAGCGCAGACGCCGCCGGGG + Intergenic
1093464976 12:19439851-19439873 CAGCAGCGCCGCCACCGCCTCGG - Exonic
1094025804 12:25958832-25958854 CCCCAGCGCCAACGCCGCCGCGG - Intergenic
1094375384 12:29783684-29783706 CCGCAGCCCCGCCGCCGGGAGGG + Exonic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1097053001 12:56234934-56234956 CCGGAGCGCCGATGCAGACGCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1097989927 12:65824205-65824227 CCCGGGCGCCGCCGCCGCCGAGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102256426 12:111418195-111418217 CCGCGGGGCCGCCGCCGGGGAGG - Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1102853961 12:116277514-116277536 CCTCGGAGCCGCCGCCGCCGCGG + Intergenic
1103969440 12:124660894-124660916 CTGCAGCGCCCCAGCCGACAAGG + Intergenic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104448841 12:128853532-128853554 CGGCCCCGCCGCCGCCGACCAGG - Exonic
1105492548 13:20902718-20902740 CCCCAGCGCCGCCGCCATCATGG + Exonic
1106187805 13:27424565-27424587 GCGCAGCAGCGGCGCCGACGCGG + Exonic
1108690019 13:52851297-52851319 TCCCGGCGCCGCCGCCGTCGTGG - Intergenic
1114474085 14:22981976-22981998 CCGCGGGGCCGCCGCCCACCCGG - Exonic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1119249037 14:73136551-73136573 CCGCCGCCCCGCTGCCGCCGCGG - Exonic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1122082153 14:99273638-99273660 CCTCAGCGCCGCCTCCCTCGGGG + Intergenic
1122993283 14:105248924-105248946 CAGCAACGCCGGCGCCGCCGTGG + Exonic
1202899792 14_GL000194v1_random:28393-28415 CCACAGCGCCGGCGCAGGCGCGG - Intergenic
1124190705 15:27574248-27574270 CCGCAGCGCCACCTGCGACCCGG - Intergenic
1125200754 15:37099072-37099094 CTGCTGCGCCGCTGCCGCCGTGG - Intronic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125626888 15:41116154-41116176 CCTCAGCGCCGCCGCCATCTTGG - Exonic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1130382127 15:83379864-83379886 CCTCATCGCTGCCGCAGACGTGG + Intergenic
1130564542 15:84982144-84982166 CCGCGGCGCCGCCGCCAGCATGG + Exonic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1132028534 15:98422059-98422081 CCGGTGCGCCGCCGCCGATGGGG + Intergenic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1135517670 16:23149156-23149178 CCGCGCCGCCGCCGCCAGCGCGG + Exonic
1135597460 16:23755127-23755149 CCCCTCCGCAGCCGCCGACGCGG - Intronic
1136458399 16:30395323-30395345 CCACAGAGCTACCGCCGACGCGG + Exonic
1136716660 16:32287896-32287918 CCGCAGTGCTGCCGTCCACGAGG + Intergenic
1136835038 16:33494141-33494163 CCGCAGTGCTGCCGTCCACGAGG + Intergenic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139433127 16:66921812-66921834 CCGCAGCGCAGCCGCCGGGCAGG - Exonic
1139448673 16:67014075-67014097 ACGCAGCGCTGCCTCCGCCGCGG + Intergenic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1203009765 16_KI270728v1_random:229891-229913 CCGCAGTGCTGCCGTCCACGAGG - Intergenic
1203145209 16_KI270728v1_random:1794462-1794484 CCACAGCGCTGCCGTCCACGAGG + Intergenic
1142739278 17:1921288-1921310 CCGCAACGCCGCCTCCCACCTGG - Intergenic
1143099818 17:4498917-4498939 CCGGAGCGCAGGAGCCGACGGGG + Exonic
1143512829 17:7405471-7405493 CCGCAGCGCCTCACCCGGCGGGG - Intronic
1143719401 17:8799244-8799266 CCGCGGCGCCGCCCCAGACCGGG - Exonic
1145912895 17:28552634-28552656 CCGCAGCCCCGCCCCCGGCCGGG + Exonic
1146895050 17:36534920-36534942 TAGCAGTGCCGCAGCCGACGGGG - Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148733383 17:49851251-49851273 CCGCAGCCCACCCGCCGCCGGGG - Intergenic
1151780177 17:76240350-76240372 CCGCAGCGCCGCAGCGGAGCCGG - Exonic
1152354147 17:79798467-79798489 CCCCAGCGCCGCCCCCGCCACGG - Intronic
1152758925 17:82098356-82098378 CCGGCGCGCCGCCGCCGGTGGGG + Intergenic
1152867980 17:82735578-82735600 CCGCAGCGCCTCAGCCGACAGGG + Exonic
1152952808 18:10929-10951 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952815 18:10958-10980 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952822 18:10987-11009 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952829 18:11016-11038 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952836 18:11045-11067 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1153382473 18:4454882-4454904 CCGCAGCCCCTCCGCGGGCGAGG + Intronic
1153553245 18:6284545-6284567 CCGCAGCGCCGCCACCTTGGAGG + Intronic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1157848976 18:51030255-51030277 CCGCAGCGGCGACGACGACCAGG - Exonic
1159511327 18:69401058-69401080 CTGCAGGGCCGCCGCGGACGGGG - Exonic
1159586805 18:70289443-70289465 CCGGCGCGCCGCGGCCGAAGAGG - Intronic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160991601 19:1862580-1862602 CCGCGTCGCCGCCGCCGGGGTGG - Intronic
1161077070 19:2290976-2290998 CCGCAGCGCGGCGGCCGGCACGG + Exonic
1161973332 19:7595984-7596006 CCGCAGCCCCGGCGCCGCCATGG + Exonic
1163445151 19:17341588-17341610 CCGCAGCGCCTCTGCCGCCAGGG - Exonic
1166736946 19:45091584-45091606 TCGCAGCGCCGGCTCCGCCGAGG + Intronic
1167268232 19:48493819-48493841 GAGCAGCGCCGACGCGGACGCGG - Exonic
1168073073 19:53963343-53963365 CCGAGGCGCCGCCGCCCCCGCGG - Exonic
927472265 2:23385393-23385415 CCCCAGCCCCGCGGCCGCCGCGG + Exonic
929966847 2:46542851-46542873 CCGGGGCGCTGCCGCCGCCGCGG - Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
933666981 2:84971628-84971650 CCGCGGCGCCGCTGCCGCCACGG + Intronic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
938496935 2:131802637-131802659 CCCCAGCGCCGGCGCAGGCGCGG - Intergenic
938727286 2:134120129-134120151 CCGCAGGGCCGCCGCCGAGCGGG - Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
941754982 2:169175294-169175316 CCGCAGCGCTTCTGCCGACTGGG - Exonic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG + Exonic
947876134 2:233469433-233469455 CCGCAGCGCCCCCGCCGTCGAGG + Exonic
948140769 2:235670462-235670484 CGGCAGCGCCCCGGCCGAGGAGG + Intronic
1168802629 20:653180-653202 CCCCATCGTCGCCGCCGCCGCGG + Exonic
1171191988 20:23165313-23165335 CCGCAGCCCCGCTCCCAACGTGG - Intergenic
1171977590 20:31605405-31605427 CAGCACCGCCACCGCCGCCGCGG + Exonic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176619167 21:9043167-9043189 CCACAGCGCCGGCGCAGTCGCGG - Intergenic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178561541 21:33643015-33643037 CCGCGGCCCCGCCGCCGAGCGGG + Intronic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1180342441 22:11629097-11629119 CCCCACCGCCGCCGCCATCGCGG - Intergenic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180871790 22:19150563-19150585 CCGCCTCGCCGCCGCCCGCGGGG + Intergenic
1181457939 22:23070309-23070331 GCGCCGCGCCGCCGCCGGCAGGG - Intronic
1182903725 22:33920047-33920069 CGGCGGCGCCGCCGCCTACGAGG + Exonic
1183650836 22:39152478-39152500 CCGCAGCTCCGCCCCCGGCCCGG - Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183720329 22:39558404-39558426 CCGCAGAGCCGCAGCCGCGGAGG - Intergenic
1185055240 22:48575801-48575823 CCGCACCATCGCCGCCGCCGGGG - Intronic
1185388980 22:50548789-50548811 CCGCAGGGCTGCCGCCGTGGCGG - Exonic
1185397658 22:50600973-50600995 CCCCAGCCCCGCCGCCGGCGCGG + Intronic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
951217763 3:20040597-20040619 CCCCTGCGCCGCTGCCGCCGGGG + Exonic
953657082 3:44862275-44862297 CCGCAGCGCCGCCCGCGGCCCGG - Intronic
953908874 3:46882163-46882185 CCCCTCCGCAGCCGCCGACGCGG - Intronic
963236695 3:142963434-142963456 CTGCAGCGACGCCCCCGGCGTGG - Exonic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
967904030 3:194486585-194486607 CCGCCGCGCCGCCTCCTCCGCGG + Intronic
968775449 4:2537019-2537041 GCGCAGCGCCGCCGCCGGGCCGG - Intronic
968908817 4:3466417-3466439 CCACAGCGCCTCCGCTAACGAGG + Intronic
969113956 4:4859995-4860017 CCCCAGCGCCGCCGCGGCCACGG + Exonic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
980958653 4:139453706-139453728 CCGCAGAGCCGCCTTTGACGGGG - Intronic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745792 4:159103340-159103362 CCCCGGCGCCGGCGCCGCCGCGG - Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
993900934 5:93584153-93584175 CCGCGGCGCCGCCGCTGTCCCGG - Exonic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
997990801 5:138543130-138543152 CCGCGGAGCCGCCGCCGGGGAGG - Exonic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
999731717 5:154480171-154480193 CCGCAGAGCCGCCGCAGCAGCGG - Intergenic
1000628539 5:163566318-163566340 CCGCAGCGCCGCGGCCGGTCCGG + Intergenic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1001563228 5:172683647-172683669 CAGTAGCGCCGGCGACGACGCGG - Exonic
1001641007 5:173244256-173244278 CCGCAGCGCTGCCGTCGGCCCGG - Intergenic
1003882923 6:10494621-10494643 CTGCTGCGCCGACTCCGACGTGG + Intronic
1004561868 6:16760221-16760243 CCGCAGCGCCTCCTCCGCGGCGG + Intronic
1004627975 6:17394092-17394114 CCCCAGCGCCGCCGCCCGCCCGG + Intronic
1004720429 6:18264162-18264184 CCGCTCCGCCGCCGCCGTCCAGG + Intronic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1007630308 6:43269753-43269775 CCGAGGAGCCGCCGCCGCCGGGG - Intronic
1008932458 6:56954896-56954918 GCGCAGCCCCGCCGGGGACGCGG + Intergenic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1020096301 7:5371272-5371294 GCCCACGGCCGCCGCCGACGCGG - Exonic
1021729955 7:23586397-23586419 CCGCAGTGCCGCCGCCATCATGG - Intergenic
1023064845 7:36367029-36367051 CCGCCGCGCCCCCGCCACCGAGG - Intronic
1024043765 7:45574291-45574313 TCGCAGCGCGGTCGCCGCCGAGG + Intronic
1024520906 7:50303904-50303926 CCGCAGCGCCGCGGCCGAGCCGG + Intergenic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1028567136 7:92245972-92245994 CAGCAGCCCGGCCGCCGACCCGG - Exonic
1029054945 7:97732262-97732284 CCGCAGCGGCGCCCCCAGCGCGG - Intronic
1029098420 7:98107291-98107313 CCGCAGCCCCGTCCCCGCCGCGG - Intronic
1029540648 7:101180234-101180256 CCGCAGCTCCGTTGGCGACGCGG + Exonic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1033361253 7:140640506-140640528 CCGCGGAGCCGCCGCCCGCGGGG - Exonic
1034589736 7:152129069-152129091 CCGCAGCTCCCCCGCCGCCAGGG - Intergenic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1042611700 8:70607894-70607916 CCGGGGAGCTGCCGCCGACGTGG + Intronic
1047292286 8:123541109-123541131 CCGCCCCGCCGCCCCCGTCGCGG - Exonic
1049405436 8:142450073-142450095 CAGCAGCGGCCCCGCCGGCGAGG - Exonic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1049784729 8:144444786-144444808 CCGCGTCCCCGCCGCCTACGAGG - Intergenic
1049936318 9:504606-504628 CCGCACGGCCGCCGCCGGGGCGG - Intronic
1049989264 9:976709-976731 CCGCAGCGCCTCCGCGAAGGAGG + Intergenic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1053352469 9:37422728-37422750 CCGCAGTGCAGCCGCCGACCCGG - Exonic
1054820451 9:69516208-69516230 CCGCCTCGCCGCCGCCCGCGGGG + Exonic
1055447058 9:76394217-76394239 CTGCGGAGCCGCCGTCGACGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1062022567 9:134326367-134326389 CCGCAGCGCCGCGGTCGGAGCGG + Intronic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185460973 X:332686-332708 CCGCAGCGCCGCCGTCCACGAGG + Intergenic
1187900943 X:24025861-24025883 CCCCCGCGGCGCCGCCGTCGGGG + Intronic
1189322632 X:40096043-40096065 CCGCAGAGCCTCCGCCAACTCGG - Intronic
1189391575 X:40581039-40581061 CCGCAGTGCTGCGGCCGCCGCGG + Exonic
1190298753 X:49043603-49043625 CCTAAGCGACGCCTCCGACGCGG + Intergenic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1193655068 X:84188292-84188314 CCGCTGTGCCGCCGCCGTGGGGG - Intergenic
1197753222 X:129979828-129979850 CCCCAGCCCCGGCGCCGAAGTGG - Intergenic
1198424092 X:136497436-136497458 CGGCCGCGCCGCCGCCCACCTGG - Exonic
1201077154 Y:10196806-10196828 CCCCATCGCCGCCGCCGTCACGG - Intergenic