ID: 1036723929

View in Genome Browser
Species Human (GRCh38)
Location 8:11201713-11201735
Sequence ACCGCCTCACTCGGGCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036723929_1036723941 18 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723941 8:11201754-11201776 GGGGCAGTGCCAGACGTTTTGGG No data
1036723929_1036723932 -7 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723932 8:11201729-11201751 AGGCGGTCCAAAGTGATCCCTGG No data
1036723929_1036723936 -1 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723929_1036723935 -2 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723935 8:11201734-11201756 GTCCAAAGTGATCCCTGGAGGGG No data
1036723929_1036723934 -3 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723934 8:11201733-11201755 GGTCCAAAGTGATCCCTGGAGGG No data
1036723929_1036723940 17 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723940 8:11201753-11201775 GGGGGCAGTGCCAGACGTTTTGG No data
1036723929_1036723942 19 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723942 8:11201755-11201777 GGGCAGTGCCAGACGTTTTGGGG No data
1036723929_1036723933 -4 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723933 8:11201732-11201754 CGGTCCAAAGTGATCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036723929 Original CRISPR ACCGCCTCACTCGGGCCAGC CGG (reversed) Intergenic