ID: 1036723930

View in Genome Browser
Species Human (GRCh38)
Location 8:11201721-11201743
Sequence CACTTTGGACCGCCTCACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036723930_1036723935 -10 Left 1036723930 8:11201721-11201743 CCCGAGTGAGGCGGTCCAAAGTG No data
Right 1036723935 8:11201734-11201756 GTCCAAAGTGATCCCTGGAGGGG No data
1036723930_1036723942 11 Left 1036723930 8:11201721-11201743 CCCGAGTGAGGCGGTCCAAAGTG No data
Right 1036723942 8:11201755-11201777 GGGCAGTGCCAGACGTTTTGGGG No data
1036723930_1036723936 -9 Left 1036723930 8:11201721-11201743 CCCGAGTGAGGCGGTCCAAAGTG No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723930_1036723941 10 Left 1036723930 8:11201721-11201743 CCCGAGTGAGGCGGTCCAAAGTG No data
Right 1036723941 8:11201754-11201776 GGGGCAGTGCCAGACGTTTTGGG No data
1036723930_1036723940 9 Left 1036723930 8:11201721-11201743 CCCGAGTGAGGCGGTCCAAAGTG No data
Right 1036723940 8:11201753-11201775 GGGGGCAGTGCCAGACGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036723930 Original CRISPR CACTTTGGACCGCCTCACTC GGG (reversed) Intergenic