ID: 1036723934

View in Genome Browser
Species Human (GRCh38)
Location 8:11201733-11201755
Sequence GGTCCAAAGTGATCCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036723929_1036723934 -3 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723934 8:11201733-11201755 GGTCCAAAGTGATCCCTGGAGGG No data
1036723921_1036723934 28 Left 1036723921 8:11201682-11201704 CCATCAGGTTGACCCCTCGGCGT No data
Right 1036723934 8:11201733-11201755 GGTCCAAAGTGATCCCTGGAGGG No data
1036723920_1036723934 29 Left 1036723920 8:11201681-11201703 CCCATCAGGTTGACCCCTCGGCG No data
Right 1036723934 8:11201733-11201755 GGTCCAAAGTGATCCCTGGAGGG No data
1036723924_1036723934 15 Left 1036723924 8:11201695-11201717 CCCTCGGCGTTTCAGAATCCGGC No data
Right 1036723934 8:11201733-11201755 GGTCCAAAGTGATCCCTGGAGGG No data
1036723925_1036723934 14 Left 1036723925 8:11201696-11201718 CCTCGGCGTTTCAGAATCCGGCT No data
Right 1036723934 8:11201733-11201755 GGTCCAAAGTGATCCCTGGAGGG No data
1036723922_1036723934 16 Left 1036723922 8:11201694-11201716 CCCCTCGGCGTTTCAGAATCCGG No data
Right 1036723934 8:11201733-11201755 GGTCCAAAGTGATCCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036723934 Original CRISPR GGTCCAAAGTGATCCCTGGA GGG Intergenic