ID: 1036723936

View in Genome Browser
Species Human (GRCh38)
Location 8:11201735-11201757
Sequence TCCAAAGTGATCCCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036723921_1036723936 30 Left 1036723921 8:11201682-11201704 CCATCAGGTTGACCCCTCGGCGT No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723924_1036723936 17 Left 1036723924 8:11201695-11201717 CCCTCGGCGTTTCAGAATCCGGC No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723922_1036723936 18 Left 1036723922 8:11201694-11201716 CCCCTCGGCGTTTCAGAATCCGG No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723925_1036723936 16 Left 1036723925 8:11201696-11201718 CCTCGGCGTTTCAGAATCCGGCT No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723931_1036723936 -10 Left 1036723931 8:11201722-11201744 CCGAGTGAGGCGGTCCAAAGTGA No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723929_1036723936 -1 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data
1036723930_1036723936 -9 Left 1036723930 8:11201721-11201743 CCCGAGTGAGGCGGTCCAAAGTG No data
Right 1036723936 8:11201735-11201757 TCCAAAGTGATCCCTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036723936 Original CRISPR TCCAAAGTGATCCCTGGAGG GGG Intergenic