ID: 1036723937

View in Genome Browser
Species Human (GRCh38)
Location 8:11201736-11201758
Sequence GCCCCCTCCAGGGATCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036723937_1036723942 -4 Left 1036723937 8:11201736-11201758 CCAAAGTGATCCCTGGAGGGGGC No data
Right 1036723942 8:11201755-11201777 GGGCAGTGCCAGACGTTTTGGGG No data
1036723937_1036723941 -5 Left 1036723937 8:11201736-11201758 CCAAAGTGATCCCTGGAGGGGGC No data
Right 1036723941 8:11201754-11201776 GGGGCAGTGCCAGACGTTTTGGG No data
1036723937_1036723940 -6 Left 1036723937 8:11201736-11201758 CCAAAGTGATCCCTGGAGGGGGC No data
Right 1036723940 8:11201753-11201775 GGGGGCAGTGCCAGACGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036723937 Original CRISPR GCCCCCTCCAGGGATCACTT TGG (reversed) Intergenic