ID: 1036723942

View in Genome Browser
Species Human (GRCh38)
Location 8:11201755-11201777
Sequence GGGCAGTGCCAGACGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036723930_1036723942 11 Left 1036723930 8:11201721-11201743 CCCGAGTGAGGCGGTCCAAAGTG No data
Right 1036723942 8:11201755-11201777 GGGCAGTGCCAGACGTTTTGGGG No data
1036723929_1036723942 19 Left 1036723929 8:11201713-11201735 CCGGCTGGCCCGAGTGAGGCGGT No data
Right 1036723942 8:11201755-11201777 GGGCAGTGCCAGACGTTTTGGGG No data
1036723937_1036723942 -4 Left 1036723937 8:11201736-11201758 CCAAAGTGATCCCTGGAGGGGGC No data
Right 1036723942 8:11201755-11201777 GGGCAGTGCCAGACGTTTTGGGG No data
1036723931_1036723942 10 Left 1036723931 8:11201722-11201744 CCGAGTGAGGCGGTCCAAAGTGA No data
Right 1036723942 8:11201755-11201777 GGGCAGTGCCAGACGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036723942 Original CRISPR GGGCAGTGCCAGACGTTTTG GGG Intergenic