ID: 1036730117

View in Genome Browser
Species Human (GRCh38)
Location 8:11255548-11255570
Sequence CAAACGAAAAACTCTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036730114_1036730117 15 Left 1036730114 8:11255510-11255532 CCCAAAAAAAACAAAAAAAAACA 0: 8
1: 285
2: 15817
3: 23606
4: 45000
Right 1036730117 8:11255548-11255570 CAAACGAAAAACTCTGTAGGTGG No data
1036730115_1036730117 14 Left 1036730115 8:11255511-11255533 CCAAAAAAAACAAAAAAAAACAA No data
Right 1036730117 8:11255548-11255570 CAAACGAAAAACTCTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036730117 Original CRISPR CAAACGAAAAACTCTGTAGG TGG Intergenic
No off target data available for this crispr