ID: 1036733282

View in Genome Browser
Species Human (GRCh38)
Location 8:11284727-11284749
Sequence CAGGCTGGGTGGGCGCGGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 0, 3: 63, 4: 475}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036733282_1036733294 2 Left 1036733282 8:11284727-11284749 CCTCGCCGCGCCCACCCAGCCTG 0: 1
1: 0
2: 0
3: 63
4: 475
Right 1036733294 8:11284752-11284774 GCGGGCCCAGCCTCACCGCCCGG 0: 1
1: 1
2: 1
3: 24
4: 259
1036733282_1036733301 20 Left 1036733282 8:11284727-11284749 CCTCGCCGCGCCCACCCAGCCTG 0: 1
1: 0
2: 0
3: 63
4: 475
Right 1036733301 8:11284770-11284792 CCCGGCCCGCCCCGCCCCACGGG 0: 1
1: 3
2: 29
3: 117
4: 665
1036733282_1036733299 19 Left 1036733282 8:11284727-11284749 CCTCGCCGCGCCCACCCAGCCTG 0: 1
1: 0
2: 0
3: 63
4: 475
Right 1036733299 8:11284769-11284791 GCCCGGCCCGCCCCGCCCCACGG 0: 1
1: 0
2: 17
3: 109
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036733282 Original CRISPR CAGGCTGGGTGGGCGCGGCG AGG (reversed) Exonic
900290407 1:1921306-1921328 CAGGCTGGGTGGGCTCTGTGGGG + Intergenic
900307785 1:2019497-2019519 CGGGCGGGGTCCGCGCGGCGCGG + Intronic
900493896 1:2967467-2967489 CAGCCTGGGTGGGAGAGGCTGGG - Intergenic
900507262 1:3035982-3036004 CAGGCTGTGTGGGGGTGGTGAGG - Intergenic
900530518 1:3150855-3150877 GAGGCCGGGTGGGGGCGGGGGGG + Intronic
900602802 1:3510217-3510239 CAGGCTGGGAGGGGCCGGCCAGG + Intronic
900991894 1:6101955-6101977 CAGCCAGGGTGGCCCCGGCGGGG - Exonic
901082808 1:6593057-6593079 CAGGAGGGGTGTGCGCCGCGTGG + Exonic
901242642 1:7704260-7704282 CAGGCAGGGCGGGCGCGGGGCGG + Intronic
901810972 1:11766626-11766648 CAGGCTGGCTGGGCTGGGGGTGG - Intronic
902280037 1:15367620-15367642 CAGGTTGGGTGGGCGGGGGCCGG + Exonic
902334019 1:15744573-15744595 CATGCAGGGTGAGCGCTGCGGGG + Exonic
902412101 1:16217651-16217673 CAGGCTGGGGAGGAGGGGCGCGG - Intergenic
902600156 1:17535468-17535490 CAGACTGGGAGGCAGCGGCGGGG + Intergenic
903324705 1:22563361-22563383 CGGGCCGGGTGGCCGCGGTGCGG + Intergenic
903788447 1:25876131-25876153 CAGGCTGGGTGCACTCGGCTGGG - Intergenic
904023896 1:27490113-27490135 CAGGCAGGGCGAGCGCGGCTGGG - Exonic
904041996 1:27590497-27590519 CAGGCTGGGTGTGTGCTGAGGGG - Intronic
904208825 1:28872325-28872347 CAGGCTGTGTGGGCAGGGCCAGG + Intergenic
904259744 1:29281471-29281493 CAGGCTTGGTGGGAGGGGAGCGG + Intronic
905393353 1:37651977-37651999 CAGGCTGTGTGGGGGAAGCGAGG + Intergenic
905717144 1:40161649-40161671 CTGGCTGGCTGAGGGCGGCGGGG + Intronic
905772885 1:40649772-40649794 CAGGCTGAGTGGGCCAGGCTGGG - Intronic
906078402 1:43068387-43068409 CGGGCCGGGAGGGGGCGGCGGGG + Intergenic
906143257 1:43545989-43546011 CAGGCTGAGGGGGAGGGGCGAGG + Intronic
906191762 1:43903539-43903561 TAGGCTGGGTGGGTGTGGGGTGG + Intronic
907213466 1:52842779-52842801 CAGGCGTGGTGGGCGCGTCCTGG + Exonic
908544000 1:65147472-65147494 CAGGCTGGGTGGGAGTGGAGTGG + Intergenic
910676625 1:89821830-89821852 CAGGCGCGGGGGGCGGGGCGCGG - Intronic
911633987 1:100213391-100213413 GCGGCTGCGGGGGCGCGGCGGGG - Intronic
912203086 1:107480567-107480589 AGGGGTGGGTGGGCGCGGGGAGG - Intronic
912514608 1:110210244-110210266 GGGGCGGGGTGGGCGGGGCGCGG - Intergenic
912652044 1:111448757-111448779 CAGCCTGAGTGGGCGCTGCTGGG - Exonic
912709967 1:111943136-111943158 CAGGCTGGATGGACGGGGCGGGG + Intronic
913300686 1:117366765-117366787 CAGGCTGGGTGGGGGAGGGGCGG + Intergenic
914673449 1:149889447-149889469 CCGGGTGGGTGGGGGCGGGGTGG - Intronic
915427185 1:155836491-155836513 CAGTCTGGGAGGCCGAGGCGGGG - Intronic
915564503 1:156706149-156706171 GAGGCTGGGCGGGGGCGGCACGG + Intergenic
916761343 1:167820363-167820385 CAGGCGGGCTAGGCGAGGCGCGG - Intronic
916787691 1:168098282-168098304 CAGGCCGGGTGGACGGGGCCGGG + Intronic
917520360 1:175743227-175743249 CAGGCTGGGGGTGGGCGGCCGGG + Exonic
919929849 1:202214206-202214228 CGGGCTGGGAGTGCACGGCGCGG + Intronic
922178402 1:223215056-223215078 GAGGCTGGGTAGGGGCGGGGAGG - Intergenic
922518246 1:226223869-226223891 CAGGCTGGCGGGGGGCGGCGGGG - Exonic
924101887 1:240612091-240612113 CAGCCTGGGACCGCGCGGCGCGG - Exonic
924336230 1:242989144-242989166 CAGGCTGGGTGGGGGCGGGTAGG + Intergenic
924706725 1:246508360-246508382 TAGGCCGGGTGGGCTGGGCGCGG - Intergenic
924707543 1:246511820-246511842 CTGGCTGGGTGGGCTGGGCAGGG - Intergenic
924784503 1:247183091-247183113 GAGGCTGGGTGGGAGCGGGGAGG - Intergenic
1063381820 10:5590545-5590567 CAGGGAGGGGGGGCGCGGTGGGG - Intergenic
1063448191 10:6133520-6133542 CAGGCCGTGGGGGCGGGGCGGGG - Intergenic
1065024382 10:21526603-21526625 CAGGCGGGGGAGGCGCGGCGGGG - Intergenic
1065342680 10:24722706-24722728 CAGCCTGGCTGGGGCCGGCGTGG + Intronic
1065510353 10:26472083-26472105 CAAGATGGGTGGGGGCTGCGGGG + Intronic
1067040671 10:42951734-42951756 CAGCCTGGGTGGGCCTGGCCTGG - Intergenic
1067086691 10:43243804-43243826 CAGGCTGGGTGGCCGGGCAGAGG - Intronic
1067211037 10:44260702-44260724 CAGGCTTGGTGGTGGCGGCAGGG - Intergenic
1067462171 10:46465976-46465998 CAGGCTGGGCGGGCGCAGGCGGG - Intergenic
1067625025 10:47918622-47918644 CAGGCTGGGCGGGCGCAGGCGGG + Intergenic
1067698518 10:48552468-48552490 CAGGCTGGGTGGGTGAAGGGTGG - Intronic
1067848124 10:49738890-49738912 CAGGCTGGGTGTGGGGGGCTGGG - Intronic
1069034168 10:63630367-63630389 CAGGGTGGGTGGGTGCAGTGAGG + Intergenic
1069846695 10:71377170-71377192 CAGGCTGGGGTGGCACGGCAGGG + Intergenic
1069901468 10:71708918-71708940 CAGCTTGGGTGGGCTCAGCGGGG - Intronic
1071579492 10:86756594-86756616 CAGGAGGGGAGGGGGCGGCGCGG - Intergenic
1072757554 10:98030826-98030848 CAGGCTGGCCCGGCGCGGCGCGG + Exonic
1073432200 10:103494036-103494058 CCGGCTGGGGGTGGGCGGCGCGG - Exonic
1074377156 10:112950150-112950172 CAGCCGGGGTGGGCGGGGCGGGG - Intergenic
1076217934 10:128710941-128710963 TAGGCTGGGTGGGAGAGGCAGGG - Intergenic
1076530576 10:131141825-131141847 GAGGCTGGGTGGGCAGGGCAGGG - Intronic
1076792671 10:132785497-132785519 CGGGGCGGGTGGGCGCGGAGGGG - Intronic
1076908286 10:133373803-133373825 CAGGCACGGTGGCAGCGGCGTGG + Intergenic
1077051300 11:568253-568275 CGGGCTGGGCAGGCGCGGCGGGG - Intergenic
1077051450 11:568673-568695 CCAGCTGCGAGGGCGCGGCGGGG + Intergenic
1077074950 11:696071-696093 CGGGCAGGGTGGGTGCGGAGCGG + Intronic
1077079935 11:720783-720805 CAGGAGGGCGGGGCGCGGCGCGG - Intronic
1077310601 11:1887338-1887360 CAGGCAGGGTGGGTGCAGCAGGG + Intronic
1078660025 11:13278487-13278509 GAGGCTGGGTGGGGGCGGGGAGG + Intronic
1080360925 11:31512801-31512823 GGGGTTGGGTGGGCGGGGCGGGG - Intronic
1080725785 11:34898669-34898691 CACTCTGGGTGGGAGCGGGGAGG - Intronic
1081866147 11:46361758-46361780 CTGGCTGGGTGGGTGCGGGGAGG + Intronic
1083263612 11:61536115-61536137 CAGGATGGGTGGGCATGACGAGG + Intronic
1083303740 11:61752510-61752532 CGGCCGGGCTGGGCGCGGCGCGG + Intergenic
1083316432 11:61817193-61817215 CAGGAAGGGTGGGCGGGGCCGGG + Intronic
1083334897 11:61916824-61916846 CAGGCTGCGGGGCCGGGGCGGGG + Intronic
1083584872 11:63849460-63849482 CAGGTTTGGTGGGCCGGGCGCGG + Intronic
1084336346 11:68460278-68460300 CGGGCGGGGCGGGGGCGGCGGGG - Intergenic
1087014630 11:93543256-93543278 CAGGTGGGCTGGGAGCGGCGCGG - Exonic
1090616753 11:128522229-128522251 CAGGAGGAGCGGGCGCGGCGCGG - Intronic
1090828301 11:130403370-130403392 CCGGTTGTGTGGGCTCGGCGAGG - Intergenic
1090923616 11:131230485-131230507 GAGACTGGGTGGGGGCGGGGTGG + Intergenic
1091398582 12:169429-169451 CAGGCTGTCTGGACGAGGCGAGG + Intronic
1091604286 12:1936891-1936913 CAGGCTGGGGCAGCGCGGCGTGG - Intergenic
1091727270 12:2854859-2854881 CAGGCTGGGTGGGCTCCCTGAGG + Intronic
1091750560 12:3019167-3019189 CCAGGTGGGTGGGCGCTGCGTGG + Exonic
1092249317 12:6883867-6883889 CAGGATCTGTGGGCGCGGCCAGG + Intronic
1092297357 12:7210929-7210951 GAGGCTGGGTGGGAGCGGGGAGG + Intronic
1096016973 12:48285521-48285543 CAGGCTGGAAGGGCTGGGCGCGG - Intergenic
1096523144 12:52195275-52195297 CAGGTTGGGTGGGAGTGACGTGG - Intergenic
1096778502 12:53978460-53978482 GGGGTGGGGTGGGCGCGGCGGGG - Intergenic
1097981463 12:65741507-65741529 CAGTCTGGGGGGGCGTGGCCGGG + Intergenic
1098425843 12:70365735-70365757 CTGGCGGCGTGGGCGCGGCTGGG + Intergenic
1098426014 12:70366378-70366400 GAGGCGGGGTGGGGGAGGCGGGG + Exonic
1098482497 12:70982029-70982051 CACCCTGGGTGGGCATGGCGGGG + Intergenic
1099956069 12:89353550-89353572 CAGGCTGCGGGGGCTCGGCAGGG + Intergenic
1102257468 12:111424602-111424624 CAGGCTTGGTGGTTGCTGCGGGG + Intronic
1102417892 12:112780336-112780358 CAGGGAGGGTGGGAGGGGCGAGG - Intronic
1102466991 12:113135752-113135774 CAGGCTGGGCGGGCAGGGGGCGG + Intronic
1102896100 12:116599761-116599783 AAGGGTGGGTGGGTGGGGCGGGG - Intergenic
1103008665 12:117440887-117440909 CAGGCAGGGTGGGAGCGCCCGGG - Intronic
1103500713 12:121399917-121399939 CTGGCTGGGAGTGCGCGGGGAGG - Intergenic
1103928688 12:124437720-124437742 CAGGGTGGGTGGGGGTGGGGGGG - Intronic
1104748439 12:131223958-131223980 CAGGCTGGATGTGGGCGGCAGGG + Intergenic
1104937719 12:132375397-132375419 CAGGCTGGGTGGGTGGGGGGAGG - Intergenic
1104961537 12:132490460-132490482 CGGGCTGAGTGTGCGCCGCGCGG - Exonic
1104978604 12:132563034-132563056 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978614 12:132563061-132563083 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978624 12:132563088-132563110 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978634 12:132563115-132563137 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978644 12:132563142-132563164 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978654 12:132563169-132563191 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978664 12:132563196-132563218 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978674 12:132563223-132563245 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978684 12:132563250-132563272 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1104978728 12:132563369-132563391 CAGGCTGTGGGGGCCAGGCGTGG - Intronic
1105472287 13:20704381-20704403 CAGGCGGGGAGGGTGGGGCGGGG + Intronic
1105770843 13:23610507-23610529 CAGGCAGGGTGGGCTGGGCTGGG - Intronic
1106109028 13:26760786-26760808 TGGGCCGGGCGGGCGCGGCGGGG - Intergenic
1106166558 13:27251937-27251959 TAGGCTGTGTGGGGGCCGCGTGG + Intronic
1107481444 13:40789361-40789383 CGGGCTGGCTGTGCGCGCCGCGG + Intergenic
1107513862 13:41110139-41110161 TAGCCTGGGTGGGCCGGGCGCGG + Intergenic
1112290860 13:98143263-98143285 CAGGCGGGGTGGGTGGGGAGCGG - Intronic
1113113389 13:106848634-106848656 GAGGGTGGGGGGGCGGGGCGGGG - Intergenic
1113566056 13:111320386-111320408 CAGGCTTGGTGGGCAAGGGGCGG + Intronic
1114450451 14:22822115-22822137 CAGGTTGGGCGGGGGCGGAGAGG - Intronic
1115576194 14:34714501-34714523 CTGGCCGGGAGGCCGCGGCGAGG - Intronic
1115752798 14:36507608-36507630 CAGGATGGGTGGGGGGGGGGCGG + Intronic
1117072568 14:52069487-52069509 CAGGCTGGCAGGGCGCGGGCGGG + Intergenic
1118796959 14:69152714-69152736 GAGGCTGGGAGGGTGCGGGGAGG + Intronic
1118900684 14:69982957-69982979 CAGGCTTGGTGGAGGCGGCTCGG - Intronic
1119325838 14:73759291-73759313 CAGGCCCGGAAGGCGCGGCGAGG - Intronic
1119734572 14:76973778-76973800 GAGGCTGGGGGGGCGGGGCGGGG - Intergenic
1121017219 14:90556165-90556187 CTGGCTGGGTGGGGGCCCCGTGG + Intronic
1121879431 14:97486902-97486924 GAGGCTGGGCGGGCGAGGCCGGG + Intergenic
1122149795 14:99718711-99718733 CAGGCTGGGTGGGAGCTCTGGGG + Intronic
1122316157 14:100827205-100827227 CAGGGTGGGAGGGGGCGGCCTGG - Intergenic
1122349032 14:101077230-101077252 CAGGCTGGGTGGACATGGAGAGG + Intergenic
1122581818 14:102776474-102776496 CAGCCTGGCTGGGCCTGGCGAGG - Intergenic
1122975200 14:105168192-105168214 GCGGCTGGGTGGGGGCGGGGCGG - Intronic
1123174195 14:106401558-106401580 TTGGGTGGGCGGGCGCGGCGCGG - Intergenic
1123182401 14:106482490-106482512 TTGGGTGGGCGGGCGCGGCGGGG - Intergenic
1202944501 14_KI270726v1_random:14239-14261 TTGGGTGGGCGGGCGCGGCGGGG + Intergenic
1124003693 15:25779952-25779974 CAGGCCGGGCGGGCGAGGTGCGG + Intronic
1124496222 15:30189068-30189090 GAGGCTGGGTGGGGGTGGAGGGG - Intergenic
1124628918 15:31326438-31326460 CGGGCCGGGTAGTCGCGGCGCGG - Intergenic
1124747352 15:32349579-32349601 GAGGCTGGGTGGGGGTGGAGGGG + Intergenic
1125348115 15:38740303-38740325 CAGCCTGGGTGGCCTCGGCCAGG - Intergenic
1125674606 15:41495384-41495406 AAGTCCGGGTCGGCGCGGCGGGG + Intronic
1126042155 15:44601870-44601892 GAGGCTGGGTGGGCTGGGCGCGG - Intronic
1126109483 15:45167146-45167168 CAGCCGGGGCGGGGGCGGCGGGG + Intergenic
1126158577 15:45587555-45587577 CGGGCTGGGTGTGAGGGGCGGGG + Intronic
1127854215 15:62941493-62941515 CAGGCTGTGTGGACGGGGCCAGG - Intergenic
1128224684 15:65993636-65993658 CAGGCTGTGTGGGGGCGGGTAGG + Intronic
1128750057 15:70142484-70142506 CAGGGTGGGGGGTGGCGGCGGGG - Intergenic
1128967774 15:72077637-72077659 CAGGGTGGCGGGGGGCGGCGCGG + Intronic
1129360626 15:75021718-75021740 CAGGCTGGATCGGCCGGGCGTGG + Intergenic
1129847092 15:78772977-78772999 CAGGCTGGGTGGGGGCCACGAGG + Intronic
1130254811 15:82320913-82320935 TAGGCTGGGTGGGGGCCACGAGG - Intergenic
1130352925 15:83107504-83107526 CGGGCTGGGAGGGCGCGCGGAGG + Exonic
1130600162 15:85269093-85269115 TAGGCTGGGTGGGGGCCACGAGG + Intergenic
1132027483 15:98415709-98415731 AAGGCTGGATGGGCCGGGCGCGG + Intergenic
1132142506 15:99407291-99407313 AGGGCTGGGTGGGCACGGCACGG + Intergenic
1132555469 16:570102-570124 CAGGGGGGGTGGGCGGCGCGCGG + Intronic
1132584836 16:701601-701623 CTGGCTGGGTGGGTGGGGCCGGG - Intronic
1132663767 16:1072730-1072752 CCGGCTGGGAGGGGGCGGGGCGG - Intergenic
1132669407 16:1096511-1096533 GTGGCTGGGCGGGCCCGGCGGGG + Intergenic
1132805144 16:1771800-1771822 CTGGCCGGGGGGGCGCGGGGGGG - Intergenic
1133055527 16:3143830-3143852 CAGGCTGGGAGAGCGGGGCCAGG + Intergenic
1133219985 16:4315824-4315846 CAGGCGGGGCGTGCGCGTCGGGG - Intronic
1133234434 16:4381368-4381390 CAGGCGGGGCAGGCGCAGCGGGG - Exonic
1133973025 16:10580587-10580609 CTGGCTGGGGGTGCGAGGCGAGG + Exonic
1134070218 16:11255939-11255961 CGGCCTGGGTGGGGCCGGCGAGG + Intronic
1138596372 16:58031381-58031403 AAGGCTGGGTGGGCCGGGGGAGG - Intronic
1139580257 16:67868970-67868992 CAGGCTAGCTGGGTGCGGAGAGG + Intronic
1139615346 16:68085326-68085348 CAGGCAGGGTGGGCGCGCGTAGG + Intronic
1140065735 16:71609740-71609762 CGGGCTGGGTTGGCGCGCCCAGG - Intergenic
1140927574 16:79599180-79599202 GAGGCGGCGGGGGCGCGGCGGGG - Exonic
1141652496 16:85401125-85401147 CCAGCTGGGTGGGTGCGGTGCGG + Intergenic
1141662156 16:85447155-85447177 CAGGCAAGGTGGGCCCGGCATGG - Intergenic
1141826683 16:86485607-86485629 GAGGCTGGGTGGGTGTGGCTGGG - Intergenic
1142024785 16:87806661-87806683 GGGGCTGGGTGGGCGCCGCCGGG - Intergenic
1142132180 16:88436172-88436194 CAGGCGGGCTGGGCCCAGCGTGG - Exonic
1142136346 16:88453560-88453582 CGGGCGGCGGGGGCGCGGCGGGG - Exonic
1142235641 16:88921371-88921393 CAAGCTGGGGTGGGGCGGCGTGG - Intronic
1142240034 16:88940856-88940878 CCGGATGGGTGGGCGCTGGGCGG + Intronic
1142261625 16:89045107-89045129 CAGGGCGGGTGGGGGCGGCAGGG + Intergenic
1142290824 16:89192976-89192998 CGGGTTGGGTGGAAGCGGCGTGG - Intronic
1142290879 16:89193145-89193167 CGGGTTGGGTGGAAGCGGCGTGG - Intronic
1142310528 16:89309898-89309920 CAGGCTGGTGGGGCCCGGCAGGG - Intronic
1142586955 17:979800-979822 CAGGCGGAGGGGGCGTGGCGTGG - Intergenic
1142697733 17:1643191-1643213 CGGGCAGGGTGGGGGCGGGGCGG - Intronic
1142764519 17:2057779-2057801 CAGCCTGGACGGGCCCGGCGCGG + Exonic
1142981410 17:3674269-3674291 CAGGCTGGATGGGAGTGCCGTGG - Intronic
1143034595 17:3987168-3987190 CAGGCTGGCTGGGAGGGGAGGGG - Intergenic
1143473826 17:7192010-7192032 CAGGCAGGGTGGGCGGAGGGGGG + Intronic
1143598464 17:7929433-7929455 CATGCTGGCTGGCCGAGGCGGGG + Exonic
1143661371 17:8326653-8326675 CAGGCTTGGGGGCCGGGGCGTGG - Intergenic
1145904338 17:28508019-28508041 CAGGCAGCGCGGGCGGGGCGGGG - Intronic
1146322661 17:31859014-31859036 CGGGCTGGGCGGGGGCCGCGGGG - Intronic
1146346389 17:32062814-32062836 GAAGGTGGGGGGGCGCGGCGAGG + Intergenic
1147168039 17:38603718-38603740 CAGTCTGGGTGGGGACAGCGGGG + Intronic
1147446127 17:40476221-40476243 GAGGCTGGGTGGGGGTGGGGTGG + Exonic
1147720440 17:42536467-42536489 CAGCCTGGGCGGCGGCGGCGCGG + Exonic
1147868944 17:43573773-43573795 CAGGGTGGGTGGGGGCTGGGAGG + Intronic
1148432083 17:47650455-47650477 GCGGCGGGATGGGCGCGGCGGGG - Intronic
1149595385 17:57861978-57862000 CGGGCAGGGTGGGCGGGACGAGG + Exonic
1149610527 17:57955323-57955345 CAGGCTCGGCGGCGGCGGCGCGG + Exonic
1149849273 17:60025826-60025848 CAGGCCGTGCGGGGGCGGCGAGG + Intergenic
1149860895 17:60120698-60120720 CAGGCCGTGCGGGGGCGGCGAGG - Intergenic
1149923039 17:60676999-60677021 CAGGCGTGGTGGGCTGGGCGTGG - Intergenic
1150398130 17:64836877-64836899 AAGGCTGGGTCGGAGCGGAGCGG + Intergenic
1150562057 17:66302777-66302799 CCGGGTGGGCGGGGGCGGCGGGG - Intronic
1150692068 17:67375475-67375497 CAGGAGGGGTGGGCTGGGCGCGG + Intergenic
1151703187 17:75753998-75754020 GAGGCTGGGTGGGCGCGGATCGG - Intronic
1152094791 17:78266801-78266823 CAGGCAGGGTGGGGGTGGTGGGG + Intergenic
1152097128 17:78278810-78278832 CAGGCTGGGTGGGAGGGGTGGGG - Intergenic
1152376620 17:79921935-79921957 CGGGCAGGGTGGGTGCTGCGGGG - Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152612747 17:81323558-81323580 CAGGAGGGGTGGGGGCGGCCCGG + Intronic
1152662686 17:81550297-81550319 CAGGCTGGCTGGGCACAGCATGG + Exonic
1152720946 17:81923641-81923663 CAGGGAGTGCGGGCGCGGCGGGG - Intronic
1152748569 17:82052168-82052190 GAGGCGGGGCGGGCGCGGCCCGG - Exonic
1152853079 17:82648787-82648809 GAGGCAGGGCGGGCGGGGCGGGG + Intergenic
1153011401 18:542956-542978 GAGGCTGGGTGGGCTGGGTGTGG - Intergenic
1154133128 18:11752645-11752667 CAGGCTGGGCGGGCAGGGCCGGG + Intronic
1155284211 18:24271884-24271906 CGGCCCGGGCGGGCGCGGCGCGG - Intronic
1159952602 18:74496251-74496273 CTGGATTGGTGGGCGTGGCGGGG + Exonic
1160053308 18:75456364-75456386 CAGGCTGTGGGGGTGGGGCGTGG - Intergenic
1160408113 18:78656636-78656658 GAGGCTGGGTGGGCGCTGCATGG - Intergenic
1160702957 19:517402-517424 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160702982 19:517453-517475 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703023 19:517546-517568 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703039 19:517577-517599 CAGGATGGGTGGGGGCTGGGAGG + Intronic
1160703079 19:517670-517692 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703167 19:517876-517898 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703238 19:518068-518090 CTGGCTGGGTGGGTGCTGGGAGG + Intronic
1160703264 19:518130-518152 CAGGCTGGGTGGGAGCTGGGAGG + Intronic
1160703318 19:518262-518284 CAGGCTGGGTGGGAGCTGGGAGG + Intronic
1160703332 19:518295-518317 CAGGCTGGGTAGGGGCTGGGAGG + Intronic
1160802097 19:974860-974882 CAGGCGGGGTGGGTGGGGGGTGG + Exonic
1160957176 19:1699147-1699169 CGGGCGGGGCGGGCGCCGCGGGG + Intergenic
1160977480 19:1800467-1800489 CAGGGTGGGTGAGGGGGGCGGGG + Intronic
1160994563 19:1876691-1876713 CCTGCTGGGTGGGCGCGATGAGG - Intergenic
1161118818 19:2513782-2513804 CAGGCTGGGGAGCCGCGGCAGGG - Exonic
1161156053 19:2732402-2732424 CAGGCTGGGGGTGTGCGGCAGGG + Intronic
1161204987 19:3036281-3036303 CAGCCTGGGCGGGAGCCGCGCGG - Intronic
1161282498 19:3453637-3453659 CAGGCTGGGGGGCCAGGGCGCGG - Intronic
1161345894 19:3768554-3768576 CAAGCTGGATGGGCGGGGCGGGG + Intronic
1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG + Intronic
1161432648 19:4242488-4242510 CAGGCTGGGGGGCAGTGGCGTGG + Intergenic
1161490104 19:4556855-4556877 CTGGCGGGGTGGGCGTGGCCTGG + Intronic
1161505222 19:4640057-4640079 CAGTCTGGGTGGGCCCGGGCTGG - Exonic
1161805775 19:6442156-6442178 GAGGCTGGGAGGGGGCGGGGGGG + Exonic
1162525376 19:11203482-11203504 CAGGCTGGGTGGGAGCTGGGTGG - Intronic
1162745179 19:12793884-12793906 GAGGGGGCGTGGGCGCGGCGGGG - Intronic
1162778681 19:12995708-12995730 CGGGCCGGGCGGGCGCAGCGCGG + Exonic
1163153804 19:15429477-15429499 CAGGGTGGGTGGGGGCGGTGGGG - Intronic
1163161144 19:15464614-15464636 CAGGCTGGGAGGGCACAGTGCGG + Intergenic
1163255495 19:16153499-16153521 AAGGCTCGGTGGGCGTGGCCTGG + Intronic
1163302829 19:16458444-16458466 CAAGCGGGGTGGGGGCGGGGCGG - Intronic
1163314973 19:16535541-16535563 CCGGCGGGATGGGCGCGGCGGGG + Exonic
1163435424 19:17292501-17292523 CAGGCTGCCTGGGCGGGGCGTGG - Exonic
1163734327 19:18969728-18969750 CAGGGTGGGAGGGGGCGGGGTGG - Intergenic
1164120559 19:22261756-22261778 CGGGCGGGGCGGGCGGGGCGGGG + Intergenic
1164670441 19:30069284-30069306 CAGGCTGGGTGGGCAGGGTAGGG + Intergenic
1164746707 19:30621719-30621741 CAGGCTGGGTGGATGCCGTGGGG + Intronic
1164927076 19:32139166-32139188 CAGGCTGGGTGGCCGACGTGGGG - Intergenic
1165058599 19:33194366-33194388 CGGGCGGGCTGGGCGCAGCGCGG + Intronic
1165266528 19:34666604-34666626 CAGGCCCGGTGGGCGTGGCTTGG - Intronic
1165413666 19:35677915-35677937 CAGGCTGGGTGGGCTGGGGGTGG + Intronic
1166120640 19:40684398-40684420 CAGGGTGAGTGGGCGCGGCAGGG - Exonic
1166343201 19:42150796-42150818 CAGGCCGGGTGGGGGTGGGGTGG + Intronic
1166355197 19:42223216-42223238 CAGGCTGGCTGGGCCGGGTGTGG + Intronic
1166367336 19:42284325-42284347 CAGGCGGGGCAGGCGGGGCGGGG - Intronic
1166368708 19:42290150-42290172 CAGGCTGGATGGGCATGGCTAGG + Intronic
1166781896 19:45347457-45347479 CAGGCTGTCTCGGCGAGGCGGGG - Exonic
1167311423 19:48739763-48739785 CAGGGTGGATGGACGGGGCGGGG + Intronic
1167506388 19:49873173-49873195 CGGGCGGGGTGGTGGCGGCGGGG + Exonic
1167618811 19:50550214-50550236 CAGGCCGGGAGGGCGCAGAGGGG + Intronic
1167694858 19:51009378-51009400 CAGGCTGGGAGGGCAGGGAGAGG + Intronic
1167738670 19:51311687-51311709 GGGGCTGGGGGGGCGCGACGAGG - Intergenic
1168347097 19:55655252-55655274 CAGGGTTGGGGGGCGCCGCGCGG - Intronic
925306517 2:2850939-2850961 CAGGCTGGCTGAGCGGGGAGGGG - Intergenic
925730596 2:6917511-6917533 CGGGCTGCGCGGGCGCGGGGAGG + Exonic
926217065 2:10912250-10912272 CAGCCTGCGGGGGCGCGCCGCGG - Exonic
927111745 2:19868847-19868869 CGGGCGGGTTGGGCACGGCGAGG - Intergenic
927197572 2:20558849-20558871 CTGGCTGGGTGGGCGCTGCTGGG + Intergenic
930762521 2:55050861-55050883 CTGGCTGGGAGGGGTCGGCGCGG + Intronic
932812026 2:74833940-74833962 CAGCCTGGGGAGGCGCGCCGGGG - Intergenic
934990970 2:98921273-98921295 CAGTCTGGCAGGGCGCGGCAGGG + Intronic
935112345 2:100104912-100104934 CGCGCGGGGCGGGCGCGGCGCGG - Intronic
937261116 2:120587299-120587321 CAGGGTGGGAGGGCAGGGCGCGG + Intergenic
937340621 2:121088459-121088481 CAGGCTGGGTGGGAGCCCCGCGG + Intergenic
937645089 2:124257722-124257744 CATGTTGGGTGGGGGCGGAGGGG - Intronic
937977834 2:127592657-127592679 CAGTGGGGGTGGGCGGGGCGGGG + Intronic
938243964 2:129763348-129763370 CAGGCTGGGTGGGCCCGCATTGG + Intergenic
938402655 2:131005722-131005744 CAGGCTGTGTGGGCACTGGGGGG + Intronic
941095497 2:161236993-161237015 GAGGCTGGGTGGGCGGGAAGTGG - Intergenic
941917751 2:170823393-170823415 AATGCAGGGAGGGCGCGGCGCGG - Intronic
943333900 2:186590561-186590583 CTGGGTGGGTGCGCGCGGTGGGG - Intronic
946419327 2:219556192-219556214 CAGGCCGAGTGGGTGCAGCGGGG - Exonic
946743068 2:222818775-222818797 TAGGCTGGGTCGGCTGGGCGCGG + Intergenic
947910331 2:233796324-233796346 CAGGGTGGGTGGGGTGGGCGGGG + Intronic
948367775 2:237469611-237469633 AAGGCGGGGTGGGGGCGGGGTGG + Intergenic
948645419 2:239401054-239401076 CCGGCTGGCTGGGCGGGGCCGGG - Intronic
948975506 2:241461273-241461295 CTGGCTTGGGGGGCGCGGAGGGG - Intronic
948981299 2:241496257-241496279 CACTCTGGGAAGGCGCGGCGTGG - Intronic
948988651 2:241541077-241541099 CAAGCAGGGCGGGCGCGGAGCGG - Intergenic
949012069 2:241686635-241686657 CCGGGTGGGTGCGCGCGGCGGGG - Exonic
1168769808 20:408036-408058 CAGGCGGGGTGGGCGGGGCCGGG - Exonic
1168771783 20:420637-420659 CAGGCAGGTTGGGAGGGGCGGGG - Intronic
1168808767 20:689066-689088 CTGGCTGGGTGTGCGATGCGGGG + Intergenic
1169006061 20:2207855-2207877 CAGGCTGGGTGCGCGTGGGGCGG - Intergenic
1169204590 20:3732648-3732670 CGGGCGGGGTGGGCGGCGCGAGG + Exonic
1169706690 20:8514146-8514168 CAGCCTGGGTGGGCCGGGCATGG + Intronic
1171361615 20:24590264-24590286 CAGGTGGGGCCGGCGCGGCGGGG + Intronic
1172547362 20:35772213-35772235 CAGGCTGGGCGAGCGGGGCCAGG - Intronic
1173734310 20:45348490-45348512 CGGGCGGGGTGCGGGCGGCGGGG - Intergenic
1174287627 20:49483815-49483837 CAGGCTGGAGGGGAGCGGGGTGG - Intergenic
1174365587 20:50054384-50054406 CTGGCTGGGTGGCCGCTGGGTGG + Intergenic
1174419558 20:50390836-50390858 CAGGGTAGGTGGACGGGGCGTGG - Intergenic
1174423417 20:50415653-50415675 CAGGCTGGGTAGGCCAGGCCGGG + Intergenic
1174658693 20:52192145-52192167 CGGGGTGGGTGCGCGGGGCGCGG + Intronic
1175715413 20:61252112-61252134 GAGGCTGGGCTGGTGCGGCGCGG + Intergenic
1175715771 20:61253252-61253274 GACGCCGGGCGGGCGCGGCGCGG + Intronic
1175853059 20:62104113-62104135 CAAGCAAGGTGGCCGCGGCGGGG + Intergenic
1175950668 20:62581514-62581536 CAGGCTGGGTGGTGGTGGTGGGG - Intergenic
1176194691 20:63831587-63831609 GGGGCTGGGGCGGCGCGGCGCGG + Intergenic
1176234831 20:64049372-64049394 CGGGCGCGGCGGGCGCGGCGAGG + Exonic
1176423309 21:6533045-6533067 CAGGCTGGGTAGGGGCTGAGGGG + Intergenic
1179698802 21:43141361-43141383 CAGGCTGGGTAGGGGCTGAGGGG + Intergenic
1179982124 21:44901072-44901094 CAAACTGGGTGGGCGGGACGTGG + Intronic
1180871605 22:19150006-19150028 CTGGGTGAGTGGGCGCGGAGCGG - Exonic
1181024076 22:20117688-20117710 CAGGGTGGGCGGGCGGGGCCGGG + Intronic
1182024683 22:27108872-27108894 CAGCCAGGGTGGGGGCGGGGGGG - Intergenic
1182358459 22:29733383-29733405 CAGGTTGGGTGGGTGCAGCAGGG - Intronic
1182547677 22:31085284-31085306 GAGGCAGGGTGGGCGAGGCGAGG + Intronic
1183094162 22:35542162-35542184 CAGGCTGGGAGGGAGCAGCCAGG + Intronic
1183311023 22:37109573-37109595 CTGGCTGGGTGGGGGTGGGGAGG - Intergenic
1183412169 22:37661216-37661238 CAGGATGGGTGGGCACAGCCAGG - Intronic
1183578315 22:38706358-38706380 GAGGCTGGGTTGGCGACGCGGGG - Intronic
1183668716 22:39259609-39259631 CAGGGTGGGTGGGAGGTGCGTGG + Intergenic
1184361984 22:44024347-44024369 CGGGGTGGGCGAGCGCGGCGCGG - Intronic
1184678568 22:46056496-46056518 CAGGCTGCGTGGACGCTGCCCGG - Intronic
1184738082 22:46410802-46410824 CAGCCTGGGTGGGCGGGGCTTGG - Intronic
1184785322 22:46668756-46668778 CAGGCCGGGCGGGCGCCGCAGGG - Intronic
1184797064 22:46738555-46738577 CAGGCGGGGTCCGGGCGGCGTGG + Intergenic
1184892484 22:47388539-47388561 CAGACAGGGTGGGCGCTGAGAGG + Intergenic
1185037917 22:48489423-48489445 CGGGCGGCGCGGGCGCGGCGCGG + Intergenic
1185044688 22:48523070-48523092 CAGGCTGGATGGGGGCGGCCAGG + Intronic
1185133177 22:49052146-49052168 CAGGCTGAGCGGGGCCGGCGGGG - Intergenic
1185265776 22:49903348-49903370 CAGGGTGGGGGGGTGCGGCCGGG + Exonic
1185335827 22:50270451-50270473 CGGGCTGGGTGGCCGGGGCGTGG + Intronic
1185347515 22:50316996-50317018 CAGGGTGGGGGGGGGCGGCGAGG + Intronic
1185347547 22:50317061-50317083 CAGGGTGGGGGGGGGCGGCGAGG + Intronic
949318752 3:2785896-2785918 CAGGATGGGGGGGCGGGGGGGGG - Intronic
950509907 3:13419979-13420001 GAGGCTGGGCGGGCGCCGGGAGG - Intronic
950530292 3:13549114-13549136 CTGGCTGTGTGCGCGCGGGGCGG - Exonic
950583851 3:13879611-13879633 GAGGCCGGGTGGGTGCGGTGTGG - Intronic
951544482 3:23810800-23810822 CGCGCGGGGTGGGGGCGGCGTGG + Intronic
954296583 3:49677645-49677667 CTGGCTGGGTGGGTGCAGTGGGG + Intronic
954316313 3:49803550-49803572 GAGGCGGGGTGGGGGCGGCGTGG + Intronic
954469003 3:50675401-50675423 CAGGCTGCGCGGCCTCGGCGCGG + Intronic
954629416 3:52039988-52040010 CCGGCTGGGTGGGGGCAGCAGGG + Intergenic
954706619 3:52484463-52484485 CAGGCAGGGTGGGTGGGGCGGGG - Intronic
954812209 3:53255412-53255434 CTGGCTGTGTGGGCGCCGCCGGG - Intronic
955188009 3:56733313-56733335 CAGGCGAGGTGGGCGGGGCGGGG + Intronic
955274081 3:57530832-57530854 CAGACTGTGTGGACGCAGCGGGG + Intronic
956604974 3:71064967-71064989 CGGGGCGGGTGGGCGCGGCGCGG - Intronic
958026815 3:88058973-88058995 CAGGCGGACGGGGCGCGGCGGGG - Intronic
960797395 3:121501740-121501762 GAGGCTGGGTGGGCGGGGTTTGG + Intronic
960960607 3:123067710-123067732 CAGGCTCGGTGGGCTGGGTGGGG + Intronic
961361544 3:126371183-126371205 CAGGCTGGGCTGGCACGCCGTGG - Intergenic
961614777 3:128170134-128170156 CAGGCGGGGGAGGCGGGGCGGGG - Intronic
962263200 3:133927774-133927796 CCCGCCGGGTGGGCGAGGCGGGG - Intergenic
965558196 3:170038291-170038313 CAGGGAGGCTGGGAGCGGCGCGG - Intronic
968047017 3:195630191-195630213 CATGCTGGCTGGGCGGGGAGGGG + Intergenic
968307634 3:197659853-197659875 CATGCTGGCTGGGCGGGGAGGGG - Intergenic
968452545 4:682106-682128 CAGGCTGGGTGGGGGCTCCCGGG + Exonic
968480615 4:831511-831533 CAGGGTGGGTGGACGGGGCCAGG - Intergenic
968737043 4:2303111-2303133 CGGGCTGGGTGGGCTGGGCCTGG - Intronic
968899573 4:3424834-3424856 CAGGCGTGGTGGGCCCTGCGGGG - Intronic
969016583 4:4107586-4107608 CTCGGTGGGTGCGCGCGGCGCGG + Intergenic
969344690 4:6563495-6563517 GAGGCGGGGTGGGCGCGAGGCGG + Intronic
969344729 4:6563626-6563648 CGGGCGCGGCGGGCGCGGCGGGG + Intergenic
969703912 4:8781885-8781907 CGGGCTTGCTGGGCGCTGCGGGG + Intergenic
972396566 4:38663851-38663873 GGGGCTGGGCGTGCGCGGCGCGG - Intergenic
972762647 4:42122014-42122036 GAGGCTGGGTGGGCCGGGAGCGG + Intronic
973627824 4:52790617-52790639 CAGGCTGGATGTGCGGGTCGGGG - Intergenic
973981847 4:56314395-56314417 CAGGTTGGGAGGACGCGGAGCGG + Exonic
976092437 4:81472021-81472043 CGGGCCGGGTGGCGGCGGCGTGG - Intronic
977536567 4:98261390-98261412 CAGGCGGCGCGGCCGCGGCGGGG - Intronic
977557167 4:98497926-98497948 GAGGCTGGTTGGGCGAGGCTGGG + Intronic
979240898 4:118446167-118446189 CAGGCTGGGTGGGGGCGGGTAGG - Intergenic
979422392 4:120521235-120521257 CAGGCTAGGTGGGAGCAGCAAGG - Intergenic
981081952 4:140644906-140644928 CAGGCTGGGTGGGAACGCAGGGG + Intronic
983158809 4:164384294-164384316 TGGGCCGGGTGGGCGCGGTGGGG + Intergenic
985512621 5:321090-321112 CCGGCGGGGTGGGCGGGGCAGGG + Intronic
985548088 5:520049-520071 GGGGCTGGGTGGGGGCGGTGGGG - Intronic
985778372 5:1857085-1857107 CAGGCTGGGGCGGCGTGGGGCGG + Intergenic
985889185 5:2702312-2702334 CGGGCTGGTGGGGCTCGGCGGGG - Intergenic
985907474 5:2852147-2852169 GAGGCTGGGTGGGCCGGGCCAGG - Intergenic
985946814 5:3191742-3191764 CCGGCTGGATGGGTGCTGCGGGG + Intergenic
986721875 5:10565425-10565447 CACGTTGGCTGGTCGCGGCGCGG - Intronic
989178752 5:38556302-38556324 GGGGGCGGGTGGGCGCGGCGCGG - Intronic
992663605 5:78984894-78984916 AAGGCGGGGCGGGGGCGGCGCGG + Intronic
992663682 5:78985230-78985252 AAGGATGGGTCCGCGCGGCGCGG - Exonic
993902486 5:93593948-93593970 CAGGCTGGGTGGGAGGGAGGAGG + Exonic
993905691 5:93621174-93621196 CAGGCGCGGTGAGGGCGGCGAGG + Intronic
994366908 5:98928141-98928163 GAGCCTGGGAGGGCGCGGGGCGG - Intronic
995853755 5:116573155-116573177 CAGGGTGGGTGGGCACTGCCCGG + Intronic
997459487 5:134042342-134042364 CAGGATGGGTGGGGGCCGTGAGG - Intergenic
998143270 5:139711451-139711473 CGGGCGGGGTGCGCGGGGCGGGG + Intergenic
998176373 5:139904443-139904465 CAGGCGGCGGGGGCGCAGCGCGG - Intronic
1000870361 5:166569735-166569757 AAGGCTGGCTGGGCACGGTGTGG - Intergenic
1002202689 5:177539123-177539145 CAGGCTGGCTGGAGGCGGGGGGG + Exonic
1002297686 5:178240482-178240504 CAGGCTGGCGGGGCCCTGCGAGG - Intronic
1002330269 5:178436111-178436133 CAGGCTGAGTGGGAGGGGAGAGG + Intronic
1002559468 5:180071757-180071779 GAGGCGGGGCGGGCGCGGCCCGG + Exonic
1002888628 6:1316470-1316492 CACACTGGGCGGGCGGGGCGGGG + Intergenic
1003571981 6:7261842-7261864 GAGGCGAGGTGGGGGCGGCGGGG + Intergenic
1003995550 6:11537341-11537363 CCGGCTGGGTGCGCGCGGTGCGG - Intergenic
1006026340 6:31149519-31149541 GAGGCTGGGAGGTCGAGGCGAGG - Intronic
1006375689 6:33670589-33670611 GAGGCAGGGTGGGCGGGGCAGGG + Intronic
1007094249 6:39203630-39203652 CACGCTGGGTGGGGGCTGGGAGG - Intronic
1007390241 6:41546505-41546527 CAGGCGGCGGCGGCGCGGCGGGG + Exonic
1007557924 6:42782489-42782511 CAGGCGGGCAGGGGGCGGCGAGG + Intronic
1007702240 6:43771949-43771971 CCGGCCGGGTGCGCGCGGCGCGG + Intronic
1007784093 6:44270536-44270558 CAGGCTGGGGGGCCGGGCCGGGG - Exonic
1011965890 6:93156907-93156929 CAGGCTGTGTGGGGGTGGGGTGG - Intergenic
1015440371 6:133241040-133241062 GGGGCGGGGTGGGGGCGGCGCGG + Intronic
1016864093 6:148748248-148748270 CAGGCTAGCTGCGGGCGGCGGGG - Intronic
1018046180 6:159968855-159968877 TCGGCGGGCTGGGCGCGGCGGGG - Intergenic
1018356304 6:163021234-163021256 CAGGCAGAGTGGGAGCTGCGAGG - Intronic
1018962078 6:168456312-168456334 GAGGCAGGGTGGGTGGGGCGTGG + Intronic
1019348246 7:541079-541101 CAGGCAGGGTGTGAGCTGCGTGG - Intergenic
1019515365 7:1437654-1437676 CGGGCTGGGCGGGCCAGGCGGGG - Intronic
1019515387 7:1437736-1437758 CGGTCTGGGTGGGCCAGGCGGGG - Intronic
1019518167 7:1448591-1448613 CTGGCTCGGCGGGCGCGGCAGGG + Intronic
1019917016 7:4140163-4140185 CAGGCTGGGGTGGAGCGGGGCGG - Intronic
1020097961 7:5378945-5378967 GAGGCCGGGTGGGGGGGGCGGGG + Intronic
1022923191 7:35036971-35036993 CCGGCTGGCGGGGCTCGGCGCGG + Intronic
1023042967 7:36188535-36188557 CAGGCTGGGTGGGTCCTGCAGGG + Intronic
1023940919 7:44767966-44767988 CAGGCTGGGTGGGGGCAGGCAGG - Exonic
1025198619 7:56949186-56949208 GAGGCTGGGGGAGCGGGGCGCGG - Intergenic
1025673333 7:63627750-63627772 GAGGCTGGGGGAGCGGGGCGCGG + Intergenic
1028988131 7:97023764-97023786 CACGCTGGGTGGGGGTGGGGGGG - Intronic
1029101148 7:98131024-98131046 CAGGCTGGGTGGAAGCTGTGTGG - Intronic
1029599504 7:101555534-101555556 CAGGCTGTGTGGCCGTGGGGAGG + Intronic
1029627418 7:101728992-101729014 CAGGCTGGGTGGGGACGGCAAGG - Intergenic
1030270152 7:107661448-107661470 CAGGCTGGCCGTGCGCGCCGTGG + Intronic
1030634280 7:111931061-111931083 CAGGCTGCGTGGGCCTGGCTGGG + Intronic
1032018177 7:128392764-128392786 CTGGCTGGCTGGGCTCGGAGGGG + Exonic
1032122858 7:129169305-129169327 CAGGCGGGGCGGGCGCGTCCGGG + Intronic
1032306237 7:130734206-130734228 CAGGCGGGGCGGGCTCCGCGCGG - Intergenic
1033299844 7:140176425-140176447 GCGGCCGGGCGGGCGCGGCGGGG - Intronic
1033301643 7:140191606-140191628 CAGTCTGGGTGGCAGCGGGGTGG + Intergenic
1034441060 7:151086355-151086377 CAGGAGGGGCGGGGGCGGCGGGG + Intronic
1034617911 7:152435503-152435525 CCGGCGGGGTGGGGGCGGGGCGG - Intronic
1034979886 7:155468662-155468684 CAGGCTGGGCGGACTCGGCCAGG - Intergenic
1035187569 7:157138641-157138663 CGTGCTGGGGGAGCGCGGCGAGG - Intergenic
1035432041 7:158829563-158829585 CACGCGGGGCGGGAGCGGCGTGG + Exonic
1035728312 8:1838430-1838452 CAGGCTGGGCGGGTGCCGGGTGG - Intronic
1036688020 8:10924596-10924618 CAGGCCGGGGTGGCGGGGCGCGG + Intronic
1036733282 8:11284727-11284749 CAGGCTGGGTGGGCGCGGCGAGG - Exonic
1037957211 8:23069026-23069048 CAGGCTGACTTGGGGCGGCGCGG + Exonic
1039921790 8:41898019-41898041 CAGGGTTGGGGGGGGCGGCGGGG - Intergenic
1040495400 8:47961026-47961048 CCGGCGGGGAGGGCGTGGCGCGG + Exonic
1040871174 8:52101154-52101176 CAGGCCGGGTGACGGCGGCGGGG + Intergenic
1041753582 8:61288323-61288345 CAGGCTGAGCGGGCGCCGGGAGG - Intronic
1045336130 8:101205679-101205701 CAGGCGGGGCGGGGGCGCCGAGG - Intronic
1045510814 8:102810741-102810763 CTGGGTGGGAGGGCGCGGGGAGG + Intergenic
1046654131 8:116874471-116874493 CAGCACGCGTGGGCGCGGCGAGG + Intronic
1048464758 8:134656131-134656153 CAGGCTGGGTGGGCAGAGGGAGG + Intronic
1049194314 8:141307443-141307465 CAGGCTGGGGGTCCGAGGCGGGG + Intronic
1049250010 8:141583155-141583177 CAGGCTGGCTGGGCCTGGAGCGG + Intergenic
1049387414 8:142350162-142350184 CAGGCAGGGTGGGCAGGGCTGGG + Intronic
1049419717 8:142511243-142511265 GAGGGTGGGTGGGCGCCGAGCGG + Intronic
1049658886 8:143810907-143810929 GAGGCTGGGTGGGGGCTGCTGGG + Exonic
1049709022 8:144055424-144055446 CAGGCAGGGTGGGAGGGTCGAGG - Intronic
1049749048 8:144274930-144274952 CAGGCAGGGAGTGCGCGGCGTGG + Intronic
1049813779 8:144588548-144588570 CAGACTGGGTGCGGGAGGCGGGG + Intronic
1049838519 8:144755340-144755362 CAGGCGGGGAGGGCGCGGGGAGG - Intronic
1049861626 8:144902451-144902473 GGGGCTGCGTGGGGGCGGCGGGG + Intergenic
1053130090 9:35609696-35609718 CAGGCTGGGTGTGGGTGGCTTGG - Exonic
1053462939 9:38284679-38284701 CAGGCTGGGGGTGCGGGGCTGGG - Intergenic
1056712517 9:89002169-89002191 CAGGCTGGATGGGTGAGGCGCGG - Exonic
1057829666 9:98396789-98396811 CAGGCTGTGTGGCCGGGGTGCGG - Intronic
1057987238 9:99729741-99729763 CAGGTTGGGTGGGGGTGGGGGGG - Intergenic
1059424196 9:114210647-114210669 CAGGTTGGGAGGGGGCGGGGAGG - Intronic
1059441861 9:114312265-114312287 CAGGCTGGGGCGGCAGGGCGAGG - Exonic
1060046401 9:120344777-120344799 CGGGCGGGGTGGGGGCGGGGAGG - Intergenic
1060485018 9:124041208-124041230 CAGGCTGGGTGGGGTCTTCGCGG + Intergenic
1060733080 9:126050096-126050118 CAGGCTGGCTGGTCAGGGCGGGG + Intergenic
1060849230 9:126860791-126860813 CAGGCGGGGCAGGCGGGGCGGGG + Intronic
1060897067 9:127225018-127225040 CAGGCTGAGCGGGCGCGGGGCGG + Intronic
1060979924 9:127785999-127786021 GAGGCGGGGTCGGCGCCGCGAGG + Intronic
1061128217 9:128689755-128689777 CCGGGCGGGGGGGCGCGGCGCGG + Intronic
1061223265 9:129264805-129264827 CAGGCTTGGTGGGGGTGGTGGGG + Intergenic
1061367830 9:130181747-130181769 CAGGCAGGGCGGGTGCTGCGGGG + Intronic
1061517151 9:131096581-131096603 CAGGCTTCGCGGACGCGGCGAGG - Exonic
1061584041 9:131554963-131554985 CGGGCGGCGTGGGCGCGGCTGGG - Intergenic
1061680897 9:132242041-132242063 CAGGGTGGCGGGGCGCGGGGCGG - Exonic
1061858666 9:133456769-133456791 GAGGCTGGGTGGGTGCTGCTGGG + Intronic
1061883119 9:133577861-133577883 CAGCCTGGGTGGGCGCTTGGTGG + Intergenic
1062009598 9:134259872-134259894 CAGCAGGGGTGGGCGAGGCGGGG + Intergenic
1062022330 9:134325619-134325641 CAGGCTGGGCAGGCGCTGCCCGG - Intronic
1062022538 9:134326273-134326295 GGGGCTGGGCGGGCGGGGCGCGG + Intronic
1062069870 9:134549873-134549895 CAGGCTGGGTGGTGGAGGCTGGG + Intergenic
1062069952 9:134550125-134550147 GAGGCTGGGTGGTGGCGGCTGGG + Intergenic
1062121243 9:134835214-134835236 CAGGGGTGCTGGGCGCGGCGCGG - Intronic
1062162575 9:135088213-135088235 CGGGCTGGGCGGGCGCCGCGCGG + Intronic
1062378919 9:136277408-136277430 CAGGGTGGGTGGGTGCTGAGGGG + Intergenic
1062378938 9:136277465-136277487 CAGGGTGGGTGGGTGCTGAGGGG + Intergenic
1062538961 9:137033055-137033077 CAGGCTGGGATGGCCCTGCGGGG + Exonic
1062696238 9:137877698-137877720 CAGGGTGGGCGGGGCCGGCGCGG + Intergenic
1187281425 X:17860911-17860933 CCGGCTGGGAGGGCCGGGCGGGG - Intronic
1190215774 X:48478556-48478578 CCGGCTGGGTGGGAGGGGCCCGG + Intronic
1195716957 X:107826721-107826743 CAGCCTGGCCGGGCCCGGCGCGG + Intronic
1195899460 X:109782215-109782237 GGGGCAGGGTGGGGGCGGCGGGG + Intergenic
1196734665 X:118973762-118973784 CTGGCCGGATGGGCGCGGCAGGG - Intergenic
1198158385 X:133984805-133984827 CAGGCTGGGTAAAGGCGGCGGGG + Intronic
1198158612 X:133985738-133985760 CGGGGTGCGGGGGCGCGGCGTGG + Intronic
1199716258 X:150509109-150509131 CTGGCTGGGTGGGCAGGGGGAGG - Intronic
1200235874 X:154467475-154467497 CGGGCGGGGTGGGGGCGGGGAGG + Intronic
1200707663 Y:6456583-6456605 CAGGATGGGTGGGGGCAGTGAGG - Intergenic
1201026449 Y:9708125-9708147 CAGGATGGGTGGGGGCAGTGAGG + Intergenic
1202388615 Y:24347988-24348010 CAGGCTGGGTGGGGGCGGGTAGG - Intergenic
1202482172 Y:25322140-25322162 CAGGCTGGGTGGGGGCGGGTAGG + Intergenic