ID: 1036733817

View in Genome Browser
Species Human (GRCh38)
Location 8:11289308-11289330
Sequence CTAGTAAGAGGCAGAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036733817_1036733819 -9 Left 1036733817 8:11289308-11289330 CCTTCAGTTCTGCCTCTTACTAG 0: 1
1: 0
2: 3
3: 24
4: 228
Right 1036733819 8:11289322-11289344 TCTTACTAGACAAGTGCCTTTGG No data
1036733817_1036733820 -8 Left 1036733817 8:11289308-11289330 CCTTCAGTTCTGCCTCTTACTAG 0: 1
1: 0
2: 3
3: 24
4: 228
Right 1036733820 8:11289323-11289345 CTTACTAGACAAGTGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036733817 Original CRISPR CTAGTAAGAGGCAGAACTGA AGG (reversed) Intronic
901199868 1:7460614-7460636 CAGGTGAGAGGCAGAACTGGGGG - Intronic
903504610 1:23824743-23824765 CTAGAAAGTGGCAGAACTATTGG + Intronic
904839813 1:33365088-33365110 GTAGTAAGTGGCAGGACTGGGGG - Intronic
906466916 1:46090026-46090048 CTAGAAAGTGGCAGAAGAGAGGG + Intronic
908056099 1:60288981-60289003 CTGTTAGGAGGCAGAACTTAAGG + Intergenic
908367791 1:63444020-63444042 ATGGTGAAAGGCAGAACTGAGGG + Intronic
908693139 1:66805314-66805336 CCAGGAAGAGGGAGAACTGGAGG - Intergenic
908847190 1:68337083-68337105 CTAGGAAGTGGCAGAACTTGAGG - Intergenic
910353258 1:86324265-86324287 ATAGGAAGTGGCAGAAGTGAGGG - Intergenic
910830583 1:91457185-91457207 CTAGTAACTGGAGGAACTGAGGG - Intergenic
911911641 1:103644839-103644861 CACCTAAGAGGTAGAACTGATGG + Intergenic
911916813 1:103707111-103707133 CACCTAAGAGGTAGAACTGATGG - Intronic
911919056 1:103738977-103738999 CACCTAAGAGGTAGAACTGATGG + Intronic
912050804 1:105525974-105525996 CTAGTTAGAGGCAGCTCTGATGG + Intergenic
912418385 1:109527227-109527249 CTAGGAAGAGGCACAGTTGACGG + Intergenic
914856135 1:151352146-151352168 CCAGTTGGAGGCAGAAGTGAAGG + Intergenic
915830584 1:159126079-159126101 CAAGTTAGAGGCAGAAATGAAGG - Intronic
917691510 1:177474657-177474679 CTGGTAACAGCCAGAATTGAGGG - Intergenic
918197478 1:182235683-182235705 CCAGCAAGAGGCAGGAATGAAGG + Intergenic
918899069 1:190389292-190389314 CTACTAAGAGGAAGAAATGGGGG - Intronic
919647946 1:200114806-200114828 CTAGTAAGTGGCAGAACAGATGG + Intronic
919699438 1:200616492-200616514 GTATTAAGAGGGAGAACTGAGGG - Intronic
920504021 1:206504091-206504113 CTAGTAAGAAGGAAAACGGAAGG - Intergenic
920605387 1:207378051-207378073 CTAATCAGAGGCTGAAGTGAAGG - Intergenic
921810468 1:219506612-219506634 CCAGTGAGACGCAGAACTGCTGG - Intergenic
923143670 1:231182904-231182926 ATAAAAAGAGGCAGGACTGATGG - Intronic
924486718 1:244491587-244491609 CTAAAATCAGGCAGAACTGAGGG + Intronic
924853200 1:247851508-247851530 CTAGTAAGAGGGACAAATGAGGG + Intergenic
1062919907 10:1271892-1271914 CTCCTGAGTGGCAGAACTGAGGG - Intronic
1063781116 10:9325701-9325723 CTAGTAATAGGAAAATCTGATGG - Intergenic
1063921580 10:10938858-10938880 CTAGCAAGAGGCAGGGCAGATGG - Intergenic
1064548996 10:16479697-16479719 GCAGTAAGAGGCAGAGCAGATGG - Intronic
1068854007 10:61778275-61778297 CTATTAAGAGGCAGAGCTGAGGG - Intergenic
1070567878 10:77617528-77617550 ATAAGAAGAGGCAGAGCTGAAGG + Intronic
1070589015 10:77788477-77788499 ATAGTAATAGGGAGAACTAAAGG + Intergenic
1072321457 10:94254075-94254097 CCAGGAAGAGGCAGTATTGAAGG + Intronic
1072468204 10:95687062-95687084 ATAGTAAGAGGCAGCATTGAGGG + Exonic
1073656779 10:105425267-105425289 CTAGGTAGAGGCAGCTCTGATGG + Intergenic
1075284148 10:121168544-121168566 TTATTAAAGGGCAGAACTGAAGG - Intergenic
1075764711 10:124884269-124884291 CTAGCAAGAGGGACAACTCAGGG + Intergenic
1079469331 11:20763517-20763539 ATACTAAGTGGCAGGACTGATGG + Intronic
1079503265 11:21126470-21126492 CTTGTAAGAGGCAGAGCTGCGGG - Intronic
1080311258 11:30895379-30895401 CTAGTCTGAGGCACAACAGAAGG + Intronic
1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG + Intronic
1081065600 11:38535929-38535951 CTAGGTAGAGGCAGTTCTGATGG + Intergenic
1081854804 11:46296513-46296535 CAAGTTAGAGGCAGAAGGGACGG - Intronic
1085235736 11:75013881-75013903 CAAAGAAGAGGCAGAACTGAGGG + Intronic
1085361374 11:75890747-75890769 CTAGGAACAGGCAGTACTGTAGG + Intronic
1088859386 11:113785622-113785644 CTAGTAAAAGGCAGAAGTGCAGG - Intergenic
1088928615 11:114326996-114327018 CTAGGAGGAGGCAGAGTTGATGG + Intergenic
1090147339 11:124339602-124339624 CTAGAAACAGGAAGAACAGAGGG + Intergenic
1090149381 11:124366455-124366477 CTAGAAACAGGAAGAACAGAGGG + Intergenic
1090208823 11:124900870-124900892 CTTGTAAGAGGGAGAAGAGAGGG + Intergenic
1091981273 12:4866147-4866169 CTAGTAAGTGGCAGAACCAAGGG + Intergenic
1092316296 12:7418010-7418032 CAAATAAGAGGCAGAACAAATGG + Intronic
1092968958 12:13673073-13673095 CTAACAAGAGGCAGATGTGATGG + Intronic
1093779954 12:23123493-23123515 CTAGAAAGAGAGAGAAATGAAGG + Intergenic
1094069147 12:26394075-26394097 CTAGCACGAGGCTTAACTGAGGG - Intronic
1098131440 12:67354648-67354670 CTGGAAAGAGGCAGAGCTGAGGG + Intergenic
1098239170 12:68448864-68448886 CTAGTAATAAGCAGAAAAGAGGG + Intergenic
1098994899 12:77107846-77107868 TTGGTAAGATGCAGTACTGAAGG - Intergenic
1100735716 12:97527608-97527630 CTACAAAGATGCAGAACTGCTGG - Intergenic
1101111803 12:101493703-101493725 CTATGAATAGGAAGAACTGAAGG - Intergenic
1101376262 12:104173782-104173804 CTAGTCAGAGGCAGTTCTAATGG - Intergenic
1101511464 12:105396749-105396771 CTAATAAGAGGCAGAATTTTTGG + Intergenic
1102181832 12:110918486-110918508 CTAAAAACAGGCAGAACTGCTGG - Intronic
1102911133 12:116714960-116714982 CAAATAAGATGCAGAACTGGGGG + Exonic
1103637416 12:122318968-122318990 CTAGTGAGAGGAGGTACTGATGG - Intronic
1105741367 13:23327069-23327091 CTGGTCACAGGCAGAACTAAAGG + Intergenic
1107131352 13:36899697-36899719 CAAAGAAGAGGCTGAACTGAAGG + Intronic
1108068973 13:46607933-46607955 TTTGTATGAAGCAGAACTGAGGG + Intronic
1108904156 13:55448915-55448937 CTAGGTAGAGGCAGCTCTGATGG - Intergenic
1110593685 13:77294508-77294530 CTAGTTGGAGGCCGAATTGAAGG + Intronic
1110803040 13:79722796-79722818 TTAGCAAGAGGAAGAACTGAAGG - Intergenic
1110975360 13:81826685-81826707 TTAGTAAGAGGTAGAAATGTTGG + Intergenic
1111993560 13:95140087-95140109 TTTGGAAGAAGCAGAACTGAAGG - Intronic
1112418729 13:99228079-99228101 CAAGGAAGAGGAAGGACTGACGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116989570 14:51261299-51261321 CTTGTAAGAGGCAGGATAGAAGG + Intergenic
1122699954 14:103581704-103581726 GTAGGAAATGGCAGAACTGAAGG + Intronic
1122842965 14:104475729-104475751 CTGGTGAGAGGCAGATGTGAGGG - Intronic
1124082579 15:26515664-26515686 GTAGTAAGTGGCAGAGCTCAGGG - Intergenic
1126229625 15:46309791-46309813 CTAGTAACTGGCAGAGCTGGAGG + Intergenic
1126581796 15:50248805-50248827 CTAGTAAGTGGCACAGCTGGAGG - Intronic
1127142801 15:55994006-55994028 CTAGTCAGAGGCCGAACTCTGGG - Intergenic
1131073566 15:89480693-89480715 TAAGGCAGAGGCAGAACTGAGGG + Intronic
1131634082 15:94211277-94211299 CTAAAATCAGGCAGAACTGAAGG - Intergenic
1132923227 16:2411070-2411092 CTAGTAAGGGGCAGTACTTTGGG + Intergenic
1134418042 16:14061659-14061681 CTGGTAAGTGGTAGAGCTGAGGG - Intergenic
1134783988 16:16924329-16924351 CTAGTCAGAGGAAGAGCTTATGG - Intergenic
1135423838 16:22322633-22322655 GTAATAAGAGGAAGAACTGGGGG + Intronic
1141578749 16:84982866-84982888 CTGGTAAGGGGCAGAGCTGAAGG + Intronic
1143844359 17:9762644-9762666 ATAGGATGAGGCAGACCTGATGG + Intergenic
1143929285 17:10404395-10404417 CAAGTCAGAGGCAAAACGGAAGG - Exonic
1144083538 17:11786128-11786150 CTCCTAAGTGACAGAACTGAAGG + Intronic
1146514372 17:33477973-33477995 CTAGTCAGAGGCCAAACTGCAGG + Intronic
1147417235 17:40301240-40301262 CTAGAGAGATGCAGAAATGAAGG - Intronic
1148455687 17:47810082-47810104 CTATTGAGTGGCAGAACTCATGG + Intronic
1156616290 18:38788974-38788996 CTAGAAAGATGCAGAAAGGATGG + Intergenic
1157211199 18:45743499-45743521 CTAGTAAGTAGCAGACCTGCTGG - Intronic
1158573479 18:58616389-58616411 AGAGTAAGAGGCAGGAATGAGGG - Intronic
1160212039 18:76889044-76889066 CTAGCAAGAGTCAGAAGTGCAGG - Intronic
1160358213 18:78246656-78246678 CAAGTCAGAAGCAAAACTGAGGG - Intergenic
1161151450 19:2712224-2712246 CTATTATGAGACAGGACTGAGGG - Intergenic
1162667396 19:12225500-12225522 CTAATAAGAGGCAGAGGTGCTGG + Intronic
1164695674 19:30241821-30241843 CTAGGAAGGGAGAGAACTGAGGG + Intronic
1166008411 19:39923878-39923900 CTAGTAAGAGGTGGAGCTAAGGG - Intronic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
926841496 2:17085731-17085753 CTTGTATGAGCCAGACCTGAGGG + Intergenic
926951920 2:18252422-18252444 CCAGTCAGAGGCTGAAGTGAAGG + Intronic
926994983 2:18724965-18724987 CTAGGAAGAGGCAGAGCGGGAGG + Intergenic
928096302 2:28407154-28407176 CTAATGAGAGGCAGAAAAGAAGG - Intronic
928258547 2:29746154-29746176 CTAGAAAGAAGCAAAACTAAAGG + Intronic
928994676 2:37275062-37275084 CAAGTAAGAAGCAGAAATAATGG + Intronic
930797727 2:55410288-55410310 CTAGAAAGAGCCAGAGATGACGG + Intronic
932608234 2:73178211-73178233 CTAGTAAGTGGCAGAAGGGGGGG - Intergenic
933318652 2:80745180-80745202 TTGGTAAAATGCAGAACTGATGG + Intergenic
934614515 2:95762919-95762941 CTAGGAAGGGTCACAACTGAGGG - Intergenic
934646387 2:96061580-96061602 CTAGGAAGGGTCACAACTGAGGG + Intergenic
934764094 2:96870557-96870579 CTAGAAAGAGGCAGAATTGGGGG - Intronic
934839793 2:97617662-97617684 CTAGGAAGGGTCACAACTGAGGG + Intergenic
934916988 2:98308497-98308519 CAAGAAACAGGCAGAACAGAGGG + Intronic
936722490 2:115269720-115269742 ATAGAAAGTGGCAGAAGTGATGG - Intronic
936805090 2:116321623-116321645 CCAGTAATAGGCAGCAATGAGGG + Intergenic
937929192 2:127191734-127191756 CCAGCAAGTGGCAGAACTGAGGG + Intronic
938193818 2:129308042-129308064 CTATTAAGAGGCAGCATTGGCGG + Intergenic
938894687 2:135738320-135738342 CTACTGAGAGGCAAAACTGCTGG - Intergenic
939691285 2:145264841-145264863 CTGGGAATAGGCAGAACTTAAGG - Intergenic
940188979 2:151018458-151018480 CTAGGAAGCGGCAGAAATGCTGG - Intronic
940700587 2:157037246-157037268 CTGGGAAGTGGAAGAACTGAAGG + Intergenic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
941855658 2:170227844-170227866 CTAGTAGGGGATAGAACTGAAGG - Intronic
943115501 2:183664623-183664645 CTAGTGAGATGCATAAATGAAGG - Intergenic
946429722 2:219618834-219618856 CTAGTGAGGTGCAGAACTAAAGG - Intergenic
946712841 2:222523986-222524008 TAAGTGAGAGTCAGAACTGAAGG - Intronic
947751771 2:232536288-232536310 ATAGAATGAGGCAGAAGTGATGG + Intronic
1170087761 20:12554197-12554219 GTATTGAGAGGCAGAGCTGAAGG - Intergenic
1173144720 20:40514728-40514750 ATAGGAAGAGGCAGAAGTGAGGG + Intergenic
1173267372 20:41496920-41496942 ATAGCAAGAGGAAGGACTGATGG - Intronic
1175234865 20:57502886-57502908 TTTGTAAGAGGCAGAAGAGAAGG + Intronic
1175245563 20:57579929-57579951 CTGGGAGGAGGCAGATCTGAGGG + Intergenic
1177505709 21:22015265-22015287 CTAGGTAGAGGCAGCTCTGATGG + Intergenic
1181284449 22:21741704-21741726 TTGGGAAGAGGCAGGACTGAGGG + Intergenic
1182867260 22:33614578-33614600 CTGGTCACAGGCAGAACTGAGGG - Intronic
1183083563 22:35472852-35472874 CTAGTTGGAGCGAGAACTGAAGG - Intergenic
1183993648 22:41616623-41616645 TTATTAAGAGGAGGAACTGAAGG + Intronic
949148623 3:736276-736298 ATAGCAAGAGGCAGACTTGAAGG + Intergenic
951241519 3:20291253-20291275 CTTCTAAGAGGTAGAACAGAAGG - Intergenic
954005395 3:47586528-47586550 CTGGTTAGAGGCAAACCTGAGGG + Exonic
955714809 3:61817891-61817913 CTTGCAAGAGGAAGAACTGCTGG + Intronic
959479083 3:106849251-106849273 CTTATAAGAGGCAGAACCTAGGG - Intergenic
959974631 3:112444934-112444956 CTAGGAAGAGGGAGAAATAAAGG - Intergenic
960488487 3:118281563-118281585 CTAACAAGAGGCAGAAGTAAAGG - Intergenic
960539035 3:118844349-118844371 CTAGTGGGAGGCAGAGCTGTGGG - Intergenic
961543821 3:127618340-127618362 CAAGTCAGAGGCAGAAGTGAGGG - Intronic
961549245 3:127659217-127659239 TTAGGAAGAGGCACAACTGTGGG - Intronic
961995058 3:131233407-131233429 CTTGTAAGTGGCAGATCTCATGG + Intronic
962911793 3:139859092-139859114 CTAGTGAGAGGCAGGACTAAGGG - Intergenic
963972774 3:151447815-151447837 CAAGTAAGAGGCACAACTATCGG - Exonic
964210876 3:154226698-154226720 CTAGAGAAAGGCAGAGCTGAAGG - Intronic
965680950 3:171250642-171250664 CCAGTGAGTGACAGAACTGAAGG - Intronic
966309257 3:178575501-178575523 CTAGTGATAGTCAGAACTGACGG + Intronic
966569304 3:181423372-181423394 CTAGTAAGTGGTAGAGCTGAGGG - Intergenic
966838603 3:184069191-184069213 CTAATCAGAGGCTGAAGTGAAGG - Intergenic
971658027 4:29374954-29374976 CTAGGAAGAGGCAGTAATTATGG - Intergenic
974112250 4:57538687-57538709 CTGGTAAGTGACAGAACTGCGGG + Intergenic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
974803534 4:66850792-66850814 CAAGTAAGAGCGAGATCTGATGG + Intergenic
974917582 4:68197190-68197212 CTAAAATCAGGCAGAACTGAAGG + Intergenic
974939712 4:68451824-68451846 ATAATAAAAGGCAGAACTGATGG + Intronic
975666248 4:76738131-76738153 CTCATGAGAGGCAGAACTAAGGG - Intronic
976108249 4:81642390-81642412 CTTTTATCAGGCAGAACTGATGG + Intronic
976223259 4:82775120-82775142 CTAGCAAGAGGCAGAAGCAATGG - Intronic
976978351 4:91191971-91191993 CAAGTTAAAGGCAGAACAGAAGG - Intronic
976990803 4:91362861-91362883 ATAGTAAGAGGTAGAGCAGAGGG - Intronic
977088686 4:92640976-92640998 CTAGTAATAGGAAGAAAAGAAGG + Intronic
980043710 4:127965905-127965927 CTTGTCAGAGCCAGGACTGAAGG + Exonic
980400932 4:132284872-132284894 CCAATTAGAGGCAGAAGTGAAGG - Intergenic
980659556 4:135839770-135839792 CTGGTAAAAGGCAGTTCTGATGG - Intergenic
982494494 4:156073881-156073903 CCAATTAGAGGCAGAAGTGAAGG + Intergenic
982597919 4:157408091-157408113 CTAGTTAGAGGCAGCTCTAATGG + Intergenic
987353376 5:17041246-17041268 CTAGGAAGTGTCAGAACTGATGG + Intergenic
988078645 5:26387386-26387408 CTGACAAGAGGCAGAACTCAGGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
992341243 5:75825609-75825631 TTATTTAGAGGCAGAACTGAGGG + Intergenic
993536538 5:89093537-89093559 TTAAAAAGAGGCAGAATTGAAGG + Intergenic
993876997 5:93319046-93319068 CGTGTAAGAGGGAGAACTGTTGG + Intergenic
994893470 5:105669777-105669799 CTAGTGACAGGCAGAAAAGAGGG - Intergenic
995427872 5:112044782-112044804 CTAGGTAGAGGCAGCTCTGATGG + Intergenic
997948699 5:138224735-138224757 TTAGAAAGAGGGAGAATTGATGG + Intergenic
998344806 5:141452542-141452564 CTAGGAAGAACCAGAACTGGAGG - Intronic
999500914 5:152145745-152145767 CTAGAGAGACTCAGAACTGAAGG + Intergenic
1000091488 5:157933152-157933174 ATAGTTAGAGGAAGAAATGAAGG - Intergenic
1000656659 5:163887568-163887590 CTAGTTGGAGGCAGAAGAGATGG - Intergenic
1002137835 5:177119140-177119162 CTATTAAGTGGCAGAGCTGGGGG + Intergenic
1003128014 6:3371545-3371567 CTGGTAAGGGGCAGGCCTGAGGG - Intronic
1003470050 6:6421125-6421147 CTAGGTAGAGGCAGATCTAATGG + Intergenic
1004616964 6:17300060-17300082 CAAGTCAGAGGCAGCACTGCAGG - Intergenic
1005525077 6:26639304-26639326 ATAGTAAGAGCCAAAACAGAGGG - Intronic
1006314264 6:33280725-33280747 CTTCAAAGGGGCAGAACTGAAGG + Exonic
1007141594 6:39581129-39581151 CTACTAAGAGGAAGAAAGGAAGG - Intronic
1008793249 6:55265959-55265981 CTAGTAATAAGCAGAAAAGAGGG - Intronic
1009237235 6:61137807-61137829 CTAAAATCAGGCAGAACTGAAGG + Intergenic
1010658902 6:78545657-78545679 TTAATAAGAGGCAGAATTCAGGG - Intergenic
1013874944 6:114813675-114813697 ATACTAAGAGGTAGAATTGAGGG - Intergenic
1014438516 6:121447168-121447190 CAAGAAAGAGGAAGAACTCAAGG + Exonic
1016224947 6:141723579-141723601 CAAGTAAGTGGCAGACCAGATGG + Intergenic
1016848886 6:148596281-148596303 GTAGTAAGAGACAGAAGTGGTGG - Intergenic
1017740363 6:157400822-157400844 CTGGTAAGAGGCAGAGCCAAAGG - Intronic
1018206386 6:161440882-161440904 GTGATAAGAGGCTGAACTGAAGG + Intronic
1018967192 6:168498134-168498156 CCACTGAGAGGCATAACTGAAGG - Intronic
1020751415 7:12146311-12146333 CTAGGTAGAGGCAGCTCTGATGG + Intergenic
1020779557 7:12500223-12500245 CTAAAATCAGGCAGAACTGAAGG + Intergenic
1021884456 7:25125151-25125173 CTGGTTAGAGGCAGAGCTGTGGG - Intronic
1022669197 7:32440109-32440131 ATAGAATGAGGCAGAAGTGATGG - Intergenic
1023304140 7:38805711-38805733 CATGGAAGTGGCAGAACTGATGG + Intronic
1024225662 7:47324987-47325009 CTAGTAGGCAGCAGAAGTGATGG + Intronic
1027481192 7:78699007-78699029 CTATTTAGAGTCAGAAATGATGG + Intronic
1027783635 7:82551695-82551717 CTAGAAGGAGGAAGAAGTGAGGG - Intergenic
1030032681 7:105384263-105384285 TGAGTAACAGGCAGAACGGAAGG - Intronic
1032575821 7:133053189-133053211 ATAGTAAGAGGCAAAGCTGAAGG + Intronic
1032876451 7:136043682-136043704 CTTCTAAGGGGCAGAATTGAGGG + Intergenic
1032985111 7:137329042-137329064 CTAGTAAAAAATAGAACTGAGGG - Intronic
1033713814 7:143978640-143978662 GTAGGAAGAGGAAGAACGGATGG + Intergenic
1035606823 8:934897-934919 CTTTAAAGAGGCAGAGCTGAGGG - Intergenic
1036205780 8:6804913-6804935 CTATTAAGAAGCAGAAAAGAAGG - Intergenic
1036733817 8:11289308-11289330 CTAGTAAGAGGCAGAACTGAAGG - Intronic
1039754495 8:40509065-40509087 CTAGGATCAAGCAGAACTGAAGG - Intergenic
1041327847 8:56688269-56688291 CTAGTCAAAGGTAGAACTAACGG + Intergenic
1043290162 8:78589036-78589058 GAAGCAAGAGGCAGAATTGAAGG + Intronic
1045010233 8:97952474-97952496 CCGGAAGGAGGCAGAACTGAGGG - Intronic
1047979849 8:130169826-130169848 CTAGTAAGCAGCAGAGCTGGTGG + Intronic
1050951933 9:11608028-11608050 GTAATAAGAGGCAAAACAGAGGG - Intergenic
1051574968 9:18604870-18604892 TGAGTAGGAGGCAGAACTGGTGG - Intronic
1051610834 9:18960026-18960048 CCAGCAAGAGCCAGAGCTGAGGG + Intronic
1051805148 9:20984175-20984197 AGAGTAAGAAACAGAACTGAGGG - Intronic
1052909043 9:33863651-33863673 CTAATATGGGGCAAAACTGATGG + Intronic
1055283490 9:74701650-74701672 CTAGTAATAGAAAGATCTGAAGG - Intergenic
1055899334 9:81216992-81217014 CTAGCAAGAGGAAGAAAGGAGGG - Intergenic
1057736749 9:97669620-97669642 CTAGTACGATGCGAAACTGATGG + Exonic
1058860301 9:109111341-109111363 TTAGTAAGAAGCTGAACTGGAGG + Intronic
1060139729 9:121200123-121200145 CTAGGAAGTGGCAGTACTGGAGG + Intronic
1062076390 9:134592274-134592296 CTAGCAAGAGGCTGAGCTGGTGG + Intergenic
1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG + Intergenic
1186557252 X:10572927-10572949 CTAATAAGTAGCAGAACTGCAGG - Intronic
1187048576 X:15674533-15674555 CGAGTAGGAAACAGAACTGATGG - Intergenic
1189748714 X:44196518-44196540 ATAGTGAGAAGAAGAACTGAAGG + Intronic
1190394018 X:49961468-49961490 CAAGTAAGAGGCAACACAGAGGG + Intronic
1191759233 X:64628863-64628885 CTAGGAAGAGGCAGTTCTAATGG - Intergenic
1192169904 X:68847696-68847718 CAGTTCAGAGGCAGAACTGAAGG - Intergenic
1195809791 X:108816878-108816900 CTAGGTAGAGGCAGTACTAATGG + Intergenic
1196038109 X:111169411-111169433 CTTGTAAGAATTAGAACTGAAGG - Intronic
1198140401 X:133797044-133797066 CAAGACAGAGGCAGAACTGCTGG - Intronic
1199905292 X:152222272-152222294 ATAGAAAAAAGCAGAACTGAAGG - Intronic
1200907280 Y:8496967-8496989 CTAGTAATATGCAGAACTCCTGG - Intergenic
1201597716 Y:15691048-15691070 CTATTTAGGGGCAGAACTTAAGG - Intergenic