ID: 1036737488

View in Genome Browser
Species Human (GRCh38)
Location 8:11331226-11331248
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 4, 1: 1, 2: 5, 3: 62, 4: 514}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036737470_1036737488 29 Left 1036737470 8:11331174-11331196 CCAGCCTCCGCTGGCACCAGCGC 0: 1
1: 3
2: 0
3: 24
4: 280
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737469_1036737488 30 Left 1036737469 8:11331173-11331195 CCCAGCCTCCGCTGGCACCAGCG 0: 1
1: 3
2: 0
3: 21
4: 171
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737475_1036737488 4 Left 1036737475 8:11331199-11331221 CCAGCCCTCTGGTGCCACCAATG 0: 1
1: 2
2: 2
3: 16
4: 182
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737474_1036737488 13 Left 1036737474 8:11331190-11331212 CCAGCGCTGCCAGCCCTCTGGTG 0: 1
1: 2
2: 1
3: 33
4: 358
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737477_1036737488 0 Left 1036737477 8:11331203-11331225 CCCTCTGGTGCCACCAATGGCCT 0: 1
1: 2
2: 2
3: 12
4: 135
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737471_1036737488 25 Left 1036737471 8:11331178-11331200 CCTCCGCTGGCACCAGCGCTGCC 0: 1
1: 3
2: 3
3: 36
4: 431
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737481_1036737488 -10 Left 1036737481 8:11331213-11331235 CCACCAATGGCCTGCTGGTGGCC 0: 3
1: 1
2: 2
3: 17
4: 156
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737472_1036737488 22 Left 1036737472 8:11331181-11331203 CCGCTGGCACCAGCGCTGCCAGC 0: 2
1: 2
2: 0
3: 28
4: 342
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514
1036737478_1036737488 -1 Left 1036737478 8:11331204-11331226 CCTCTGGTGCCACCAATGGCCTG 0: 1
1: 2
2: 1
3: 29
4: 231
Right 1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG 0: 4
1: 1
2: 5
3: 62
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900008105 1:79016-79038 CCAGGTGGCCCTGCTTGGTAAGG - Intergenic
900086426 1:900012-900034 GGGGGTGGTCCTGCTGGCTGAGG + Intergenic
900164202 1:1238165-1238187 GCAGGAGGCCCTGCTGGGCTGGG + Intergenic
900186103 1:1333960-1333982 GCTGCTGGCCATGCTGGTGGAGG + Exonic
900207097 1:1436225-1436247 GCTGGTGCCCTGGCTTGGTGGGG + Intronic
900236510 1:1594182-1594204 GCTGGAGGCCCTGCATGGTCTGG - Intergenic
900402463 1:2478164-2478186 GCAGGTGGCCGAGCAGGGTGGGG + Intronic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901615883 1:10539181-10539203 TCTGGTGGGGGTGCTGGGTGAGG + Intronic
901649246 1:10734033-10734055 GCTGGTGGCTCTGCCTGGTTGGG - Intronic
902091591 1:13907855-13907877 TCTTGTGCCCCTGTTGGGTGAGG + Intergenic
902612805 1:17607182-17607204 TGTGGTGGCTCGGCTGGGTGTGG + Intronic
902757847 1:18560863-18560885 GCAGGGGGCCCTGCTCGGAGAGG + Intergenic
903329211 1:22588609-22588631 CATGGTGGTCCTGATGGGTGGGG + Intronic
903331328 1:22598485-22598507 GCTGGGGGGCATGCTGGCTGTGG + Intronic
903337749 1:22636406-22636428 GGTGGAGGCCGTGCAGGGTGAGG - Intergenic
903389405 1:22953540-22953562 GCTGGTGCCCCCGCTGCGTCTGG - Exonic
903577753 1:24349424-24349446 GCTGCTTGCCCTGCTGGGACAGG - Intronic
904033885 1:27549065-27549087 GCTGTGGGCGCTGCTGGGTGAGG + Exonic
904034515 1:27551588-27551610 GCTGTTGGCCAAACTGGGTGAGG + Exonic
904475452 1:30762070-30762092 CCTGGTGACCGTGCTGGGTTCGG - Intergenic
904967043 1:34382696-34382718 GCTGGTAGCCATGAGGGGTGGGG - Intergenic
905513416 1:38542626-38542648 GCTGAAGGCCCTGCTGGCAGGGG + Intergenic
905873148 1:41416325-41416347 GCTGAGGAACCTGCTGGGTGGGG + Intergenic
906109099 1:43311702-43311724 GCTGGCGGCTCTGCTTGGTCAGG - Exonic
906182851 1:43836716-43836738 GCTGGAGGCCCTGCATGCTGGGG - Intronic
906511646 1:46413470-46413492 GCCGGTGGCCGTGCAGTGTGTGG + Exonic
906669633 1:47645149-47645171 GCCCGTGGCCCTGCGGGGTGGGG + Intergenic
907480714 1:54743920-54743942 GCCTCTGGCCCTGCTGGGGGAGG - Intergenic
908295620 1:62709709-62709731 GCTGTAGTCCCTGCTGTGTGGGG - Intergenic
914410372 1:147421704-147421726 GCTGATGGCACTGCTTGCTGTGG - Intergenic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915280377 1:154818376-154818398 GCTGCTGGCCCCCCTGGGAGAGG - Intronic
915509350 1:156378074-156378096 GCTCATGGCCCTGCTGGAGGTGG + Exonic
916048816 1:161020773-161020795 CCTGGTGGCCGTGAGGGGTGCGG + Intronic
916188325 1:162154525-162154547 GCTGCTGGCCCTTCTAGGTAGGG + Intronic
916578581 1:166088400-166088422 TCTGCAGACCCTGCTGGGTGGGG + Intronic
918024128 1:180726296-180726318 GCAGGTTGCGCTGCTGGCTGGGG - Intronic
919739058 1:200971733-200971755 GGTGCTGGCCCTGCTGGATGTGG - Intronic
919762203 1:201105282-201105304 GCTGGTGAGCCTGCTCTGTGGGG + Intronic
920386210 1:205571706-205571728 GCTGGTGGAGCTTCTGGCTGGGG - Intronic
922783751 1:228272989-228273011 GCCTGTGGCCCTGCGTGGTGGGG + Intronic
923151936 1:231241308-231241330 GGTGGTGCTCCTGCTGGGGGCGG - Exonic
923490367 1:234478737-234478759 GCTGGCGGCCGCGCTGGCTGAGG - Exonic
1063357030 10:5410843-5410865 GTGGGTTGCCCTGCTGGCTGGGG + Intergenic
1065841873 10:29708743-29708765 GCTGGGAAGCCTGCTGGGTGTGG + Intronic
1066109374 10:32182653-32182675 GCTGCTGCCCCGGGTGGGTGGGG + Intergenic
1067702869 10:48586343-48586365 CCAGCTTGCCCTGCTGGGTGAGG - Intronic
1068405767 10:56586374-56586396 GCTGGATGCCCTGCTTTGTGAGG - Intergenic
1069996531 10:72345213-72345235 GCTGGTGGCTTTGCTGGGAGGGG - Intronic
1070289469 10:75105088-75105110 GAGGCAGGCCCTGCTGGGTGGGG + Intronic
1070637921 10:78143976-78143998 GATGCTGGCCCTGCTGGCTGGGG + Intergenic
1073096463 10:100983292-100983314 GGTGGTGGCCCTGTGGGGTTTGG - Exonic
1074581663 10:114724867-114724889 TCTGGTGGCTCTGCCTGGTGTGG - Intergenic
1075211025 10:120491123-120491145 GCTGCTGGCCCTGCTGGGTGAGG + Intronic
1075618712 10:123910138-123910160 GCAGGTGGGCCAGCTCGGTGGGG - Intronic
1075647120 10:124103923-124103945 GATGGTGTCCCTGCTGCCTGGGG + Intergenic
1075702495 10:124478372-124478394 GCAGGGGGCCCAGCTGGGAGGGG + Intronic
1075723057 10:124598433-124598455 CCTGGTGGCCTGGCTGGGCGTGG + Intronic
1075802648 10:125162015-125162037 GCTGGTGGCCGTGGAGTGTGGGG + Intergenic
1076598369 10:131639804-131639826 ACTGTTGCCCCTGCTGGGTAGGG - Intergenic
1076758688 10:132589265-132589287 GCACGTGGCCCTGCAGGGTGTGG - Intronic
1076782174 10:132730374-132730396 GCTGGTGGACGTGCTGGCCGGGG + Intronic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1076871306 10:133196329-133196351 GCTGGTCCCCATGCCGGGTGCGG - Intronic
1076899549 10:133330838-133330860 GCTGCTGTCCTTGCTGGGTTAGG - Intronic
1077218080 11:1403392-1403414 GCTGGTGCCCCTGCTGGTGCTGG + Intronic
1077227973 11:1446650-1446672 TCTGGAGCCTCTGCTGGGTGGGG + Intronic
1077366946 11:2165073-2165095 GATGGTGTCCCTGCTGTGTGGGG + Intronic
1077415381 11:2422216-2422238 GGTGGTGTCCCTGGTGGGTGAGG - Exonic
1077844878 11:6013360-6013382 GCTCGCGGCCCTGCAGGGGGAGG + Intergenic
1078386765 11:10899359-10899381 TCTGGTGGGCCAGCTGGGCGTGG + Intergenic
1079003411 11:16776069-16776091 GCTGGTGACACTACAGGGTGGGG - Intergenic
1080869770 11:36227185-36227207 GGTGGTGGCCCTGCTGGCACTGG + Exonic
1080879105 11:36302493-36302515 GATGCTGGCTCAGCTGGGTGCGG + Intronic
1081813867 11:45928028-45928050 GCTGTTGGCCTTGCTGGATGCGG + Exonic
1082009660 11:47441646-47441668 GGTGCAGGCGCTGCTGGGTGTGG - Exonic
1083528504 11:63395684-63395706 GCTGGTTGGCCTCCTGGCTGGGG + Intronic
1083828780 11:65217886-65217908 AGTGGTGGCCCTGCTGGCTGTGG + Intergenic
1084458890 11:69285329-69285351 GCTGTTCGTCCTGCTGGGAGTGG + Intergenic
1084949522 11:72657093-72657115 GCTGCTGACCCTGATGAGTGGGG - Intronic
1085098380 11:73779484-73779506 GCTGGCGGCCATGTTGAGTGTGG - Intergenic
1085529390 11:77182573-77182595 GCTGCAGGCCCTGCAGGGCGAGG + Exonic
1086595597 11:88567100-88567122 GCTGCTGGATCTGCTGGCTGCGG + Exonic
1086974048 11:93113157-93113179 TCAGGTGGCCCTGCTTGGAGGGG - Intergenic
1088425537 11:109697234-109697256 GCAGGTGGGCCTGCTTGGTCTGG + Intergenic
1088947654 11:114530693-114530715 GATGGTGGCTGTGCTGTGTGTGG + Exonic
1088963823 11:114698238-114698260 GATGGTGGCTGTGCTGTGTGTGG - Exonic
1089180757 11:116581353-116581375 ACTGGAGGCCCTCCTGAGTGAGG - Intergenic
1089519136 11:119052139-119052161 GCAGGTGATCCTGGTGGGTGGGG - Exonic
1089778253 11:120854478-120854500 GCCTGTGGCCCTGCTGGGAAGGG + Intronic
1090014431 11:123073501-123073523 GCTGGGGATCATGCTGGGTGTGG + Exonic
1090807626 11:130212226-130212248 ACTGGTGGGCCCGCTGGGTGGGG + Intergenic
1090869565 11:130731229-130731251 GATTGGGGCCCCGCTGGGTGTGG + Intergenic
1090948964 11:131455730-131455752 GCTGGTGGACATGCTGGGAGTGG + Intronic
1091315609 11:134611830-134611852 ACTGGTGGGCCTGCTGGTGGTGG + Intergenic
1093213112 12:16331078-16331100 GCTGGGGGACTTGCGGGGTGGGG + Intergenic
1093579136 12:20767857-20767879 GTTGGTGGCTGAGCTGGGTGAGG - Intergenic
1094069063 12:26392999-26393021 GAAGGTGGCCCTGGAGGGTGAGG - Intronic
1094386762 12:29903022-29903044 GCTGGTGGCACTGCTCAGTGAGG - Intergenic
1095638039 12:44454878-44454900 GCTGGTGGCTGAGCTTGGTGAGG - Intergenic
1095946650 12:47757765-47757787 GCTGGTGGCCCAGCTTGCTCTGG - Intronic
1096133167 12:49176979-49177001 GCTGGGAGCCCAGCTGGGTCTGG + Intergenic
1099222887 12:79935149-79935171 ACGGGTGGCCGTGCTGGGGGCGG - Exonic
1100397299 12:94196252-94196274 GGAGGTGGGCCTGCTGGGAGGGG + Intronic
1101536621 12:105623732-105623754 GCTGGTAGCCCTCCTTGGTGTGG + Intergenic
1102259564 12:111435966-111435988 TCTGGTGGCCCTGCCGTGTATGG + Intronic
1102350809 12:112190780-112190802 GGTGGTGGAGCTGCTAGGTGAGG - Exonic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1103023472 12:117555113-117555135 GGGGCTGGCACTGCTGGGTGAGG - Intronic
1103309173 12:119990201-119990223 GTTGGCGGCCCGGCTGGGTAAGG + Exonic
1103620541 12:122184608-122184630 GGTGGAGGCCCTGCTGGGCCTGG + Exonic
1104578514 12:129990783-129990805 ATGGGTGGCCATGCTGGGTGAGG + Intergenic
1104964873 12:132504427-132504449 CCTGGTGGTCCTCCTGGGAGAGG + Intronic
1105002899 12:132702699-132702721 GCAGGTGGCCCTTCTGGGAAAGG + Intronic
1105476332 13:20730824-20730846 CCTGGTTGCACTGCTGGCTGCGG - Intronic
1105890721 13:24680716-24680738 GCTGGTGGCGCCGCGGGCTGCGG - Exonic
1107187971 13:37546614-37546636 GCCAGGGGCCCTGCTTGGTGAGG + Intergenic
1110220040 13:73062262-73062284 ACAGGTGGCCCTGCTGGGTAGGG - Exonic
1111821698 13:93223732-93223754 GATTGTGTCTCTGCTGGGTGTGG - Intergenic
1112284988 13:98096307-98096329 CCCGATGGCCCTGCTTGGTGTGG - Intergenic
1113373706 13:109744877-109744899 GTTGGCCTCCCTGCTGGGTGTGG - Intergenic
1113941166 13:114019236-114019258 GCTGCTGACACTGCTGGGTGTGG - Intronic
1114198872 14:20504871-20504893 GCTGCTGTCCTTGCTGGGTTAGG - Intergenic
1114221246 14:20699410-20699432 GCTGCTGACCCTGCTGGGGCTGG + Exonic
1118003944 14:61548449-61548471 GCTGGTGGCCTTCCTGAGCGTGG + Intronic
1118319259 14:64743550-64743572 ACCGGTGGCCCTGCTGGGGCAGG + Exonic
1118332589 14:64825538-64825560 GCTTGTGGCCCTGCAGGAGGTGG - Intronic
1118383430 14:65236412-65236434 GCTGGTGGCTGTGCTGGGCCTGG - Intergenic
1118747739 14:68786077-68786099 ACTGGAGGCCCTGGAGGGTGGGG - Intergenic
1119741059 14:77014012-77014034 GCTGGAGGCCCTTCTGGGGCAGG + Intergenic
1119808625 14:77498724-77498746 GCTGGCGGCGCTGCTGGAGGCGG - Exonic
1121051403 14:90821076-90821098 GCTGTTGCCCCGGCAGGGTGAGG - Intergenic
1121309002 14:92924676-92924698 GCTGGAGAGCCTGCTGGGTGTGG - Intronic
1121558356 14:94855625-94855647 GATGGTGGCTCTGGTGGGTAAGG - Intergenic
1121906701 14:97752692-97752714 GCTGCTGGTCCTGCTGGCTCTGG - Intronic
1122209498 14:100165783-100165805 GCAGGCGGCCCTGCTAAGTGGGG + Intergenic
1122519260 14:102331784-102331806 CCTGGTGGCCCTGCTGCGGCAGG + Exonic
1122750212 14:103927841-103927863 GCAGGCGGCCCTGATGGCTGAGG - Intronic
1122809587 14:104281431-104281453 GAGGGTGGCTCTGCTGGGTGGGG - Intergenic
1122971403 14:105153716-105153738 TCTGGGGGGCCTGGTGGGTGGGG - Intronic
1123123656 14:105929557-105929579 GGTGCTGGCGCTGCTGGGTCAGG + Intronic
1124250094 15:28101375-28101397 GCATGTGGCTGTGCTGGGTGTGG - Intergenic
1124595255 15:31086592-31086614 CCTGGAGCCCCTGCTGGGAGAGG - Intronic
1125914579 15:43474191-43474213 GCTGGAGTTCCTGGTGGGTGTGG - Intronic
1126375172 15:47990392-47990414 TCTGGTGGCACTACTGGGTGTGG - Intergenic
1128113809 15:65093257-65093279 GCTGGGGGCTCTGCTGGGCCTGG + Intronic
1128227546 15:66012774-66012796 CCTGGTGGCCTTGATGGCTGTGG - Intronic
1128551359 15:68599979-68600001 GCTGCTGTCCCTGCTGCTTGGGG + Intronic
1129273519 15:74431748-74431770 GCTGGTGGCCCTGGGGGTGGGGG + Intronic
1129414449 15:75367613-75367635 GATGGTGGACCTGCTGGTTCCGG - Exonic
1129823699 15:78620796-78620818 GCTGGTGGCCGGGCTGGCCGCGG + Exonic
1130061811 15:80575798-80575820 GCTGCGGCACCTGCTGGGTGAGG + Intronic
1130987318 15:88853071-88853093 GCAGGTGTGGCTGCTGGGTGAGG - Intronic
1131454252 15:92570919-92570941 TCTGGTGGCTGTGCTGGGGGTGG - Intergenic
1131489691 15:92851947-92851969 GATTGAAGCCCTGCTGGGTGCGG + Intergenic
1131782239 15:95872173-95872195 GCAGGTTGCGCTGCTGGCTGTGG + Intergenic
1131979404 15:97980475-97980497 GCTGAAGGCCGGGCTGGGTGTGG + Intergenic
1132218162 15:100083257-100083279 GCAGGAGGCCCTGCAGAGTGAGG - Intronic
1132285473 15:100659068-100659090 ACTGGTGGCCGGGCAGGGTGGGG + Intergenic
1132595419 16:746881-746903 GAGGGTGGCCCTGCGGGGTGGGG - Intronic
1132601490 16:775020-775042 CCTGCTGGCCCTGCAGGGGGTGG - Exonic
1132775631 16:1592376-1592398 GCTGGGGCCCCTCCTGGGTCAGG + Intronic
1132809796 16:1792090-1792112 GCTGGCCGCCCTGCAGGTTGAGG + Exonic
1133280423 16:4661966-4661988 TATGGAGTCCCTGCTGGGTGGGG + Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1136566431 16:31073400-31073422 GCTGCTGGCCCGGCGCGGTGTGG - Intronic
1138360253 16:56422406-56422428 GCAGGTGGCTCTGCTGTGAGAGG - Intronic
1138452787 16:57103706-57103728 GCTGCTGGGCCGGCTGGGTGGGG - Intronic
1138536044 16:57660790-57660812 GCTGGTGGCCCTGGTGGATGTGG + Exonic
1139901445 16:70331772-70331794 CCAGGTGGCTCTGCTGAGTGGGG + Exonic
1139906542 16:70370273-70370295 CCAGGTGGCTCTGCTGAGTGGGG + Exonic
1139949895 16:70663730-70663752 GCTGGTGGCCATCCGGCGTGGGG - Exonic
1140060794 16:71568048-71568070 TCAGGTGGCCCTACTGGGAGAGG - Exonic
1141423249 16:83930722-83930744 CCAGGCGGCCCTGCTGGCTGTGG - Intronic
1141952035 16:87345439-87345461 GCAGGTGTCCCTGTGGGGTGAGG - Intronic
1142130009 16:88428099-88428121 GCTGGTGCCCCTGCTCTGGGGGG - Exonic
1142383642 16:89748471-89748493 GCTGGTCGCCGTCCTGGCTGTGG + Intronic
1143367192 17:6415951-6415973 GGTGGAGGCACTGCCGGGTGAGG - Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143565721 17:7719417-7719439 GATGATGGCCAGGCTGGGTGCGG - Intronic
1143822436 17:9575683-9575705 GCTGGTGGCCTTTCGGGATGAGG - Intronic
1143874612 17:9982112-9982134 GCTGGGGGCCCTTCTTGATGAGG + Intronic
1143978435 17:10847040-10847062 GCTGGAGGCCATGCAGGCTGTGG + Intergenic
1144564579 17:16349458-16349480 GCAGATGGCACTGCTGGCTGTGG - Intronic
1144854979 17:18262655-18262677 GCAGGTGGCCAGGCTGGGAGAGG - Intronic
1144954688 17:19013135-19013157 GCCGTTGGCTCTGCTGTGTGAGG - Intronic
1146184962 17:30718807-30718829 GATGCTGGCTCTGCAGGGTGGGG - Intergenic
1146273323 17:31498483-31498505 GCAGGAGGCCCTGCAGGGTTGGG + Intronic
1146649869 17:34599962-34599984 GCTGGGGGCCCTGGTGGGGAGGG + Intronic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147038952 17:37702393-37702415 GCTTCTGGCTCTCCTGGGTGGGG + Intronic
1147356967 17:39905841-39905863 CCTGGATGCCCTGCTAGGTGAGG - Exonic
1147446251 17:40476990-40477012 GCTGCAGGCCAAGCTGGGTGTGG - Exonic
1147693449 17:42333268-42333290 GGTGGTGGGCCTGTAGGGTGAGG - Intronic
1147880825 17:43652260-43652282 GGTTGTGGCAGTGCTGGGTGGGG - Intronic
1148196899 17:45720469-45720491 GCACGTGGGCCTGCTGGGTCTGG - Intergenic
1148551311 17:48552172-48552194 GCTAGTGGCACTGGTAGGTGCGG + Exonic
1148820228 17:50355735-50355757 GCTGGGGATCCTGCAGGGTGGGG - Intronic
1149567405 17:57649921-57649943 GCTGCTGCCCGTGCTGTGTGAGG + Intronic
1149784074 17:59420995-59421017 GCTGGGGGCAATGTTGGGTGAGG + Intergenic
1151178438 17:72308312-72308334 GAAGGAGGCCCTGGTGGGTGAGG - Intergenic
1151666683 17:75549371-75549393 CCTGTTTGCCCTGATGGGTGTGG - Intronic
1152097100 17:78278671-78278693 GCTGCTGCACCTGTTGGGTGTGG - Intergenic
1152323769 17:79623909-79623931 GCTGCTGGCTCCGCAGGGTGAGG + Intergenic
1152346584 17:79756205-79756227 ACTGGTGTCCCGGCTGGGCGCGG - Intergenic
1152587798 17:81196817-81196839 GCTGCTGCGCCTGCAGGGTGTGG + Exonic
1152609776 17:81309862-81309884 GCTGGGGGCCCTGCTCCGGGGGG + Intergenic
1152825615 17:82462838-82462860 GGAGGAGGCACTGCTGGGTGAGG + Intronic
1153219184 18:2847242-2847264 GCTGCTGGCCCTGGTTGGCGCGG + Exonic
1153424352 18:4945729-4945751 GCTGGGGGCTCTGCTTGTTGGGG - Intergenic
1153760033 18:8321731-8321753 GCTGGTGGCGGTGCAGGGAGAGG + Intronic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1154192970 18:12245767-12245789 TCTTTTGACCCTGCTGGGTGGGG - Intergenic
1155147539 18:23096668-23096690 GCAGGTGACTCGGCTGGGTGTGG + Intergenic
1157422051 18:47555689-47555711 GTTCGTGGCACTGCAGGGTGGGG - Intergenic
1157427382 18:47595434-47595456 TCTGGAGGCCCTGCTGGCCGTGG - Intergenic
1158509963 18:58081503-58081525 GGTGGTGTTCCAGCTGGGTGCGG - Intronic
1158800136 18:60896555-60896577 GTTGGTGGCCATGTTGGGGGAGG - Intergenic
1160424438 18:78770493-78770515 GCTGGTGGCCCTGTAGCGTCTGG - Intergenic
1160454868 18:78993032-78993054 CCCGGGGTCCCTGCTGGGTGCGG + Exonic
1160531489 18:79567591-79567613 GCTGGTGGTGCTGCTGCGGGGGG + Intergenic
1160662155 19:306212-306234 GCCCGCGGCCCTGCCGGGTGTGG + Exonic
1160763157 19:795907-795929 CCTGGTGACCCTGCTGGGCCTGG + Intergenic
1160941401 19:1621961-1621983 GCTGGTAGCCCTGGGGGGTCAGG + Exonic
1160978465 19:1805847-1805869 GCTGGGGACCCTGGGGGGTGGGG - Intronic
1161069630 19:2253638-2253660 GCTGGTGGCGCTGCTGGGCTCGG - Exonic
1161091520 19:2361926-2361948 CCTGGGGGCCTGGCTGGGTGGGG + Intergenic
1161249941 19:3275250-3275272 GCTGGACCCCCTGCTGGGTGGGG - Intronic
1161312023 19:3600121-3600143 CCTGCTGCCCCTGCTGGGCGTGG - Exonic
1161327166 19:3669464-3669486 GGTGGGGACCCGGCTGGGTGTGG + Intronic
1161422615 19:4184225-4184247 GCTCGTGGCCCAGCTGGGAGTGG + Intronic
1161425400 19:4200089-4200111 CCTGGCGGCCATGCGGGGTGCGG + Exonic
1161471224 19:4457573-4457595 GCTTGAGGCCCTGCGGGGCGGGG - Intronic
1162001560 19:7747460-7747482 GCAGCTGGGCCTCCTGGGTGAGG - Exonic
1162236548 19:9314257-9314279 GCGGGTTGCCTTGCTGGCTGGGG + Intergenic
1162377988 19:10316335-10316357 GCTGGTGGCCCAGTTGGCTGGGG + Exonic
1162440121 19:10687533-10687555 GCTGCTGGCCCTGGTGGGACTGG - Exonic
1162806068 19:13138686-13138708 CCTGGTGGGCCTGGTGAGTGTGG - Exonic
1162904961 19:13817894-13817916 GCTGCTGGCCCTGCTGGAGGAGG + Exonic
1162973813 19:14196882-14196904 GATGCTGGCTCTGCAGGGTGGGG + Intronic
1162987257 19:14278785-14278807 GCTGGTGGTCCCGCTGGCTTCGG - Intergenic
1163110908 19:15160697-15160719 GCTGGGGCCCCAGCTGGGTCTGG + Exonic
1163476438 19:17528728-17528750 TCTGGTGGCTCTGCTATGTGGGG + Intronic
1163602112 19:18255437-18255459 GCAGGTGGGGCTGCAGGGTGTGG + Intergenic
1163695353 19:18760930-18760952 GCTGGTGGCTGTTCTAGGTGGGG - Intronic
1163819701 19:19489165-19489187 GCCAGTGACCCTGCTGTGTGCGG + Intronic
1164540426 19:29117797-29117819 GATGGAGGCCCTGGTGGGTCAGG + Intergenic
1164750921 19:30654185-30654207 GCTGGTGCCCAGGCTGCGTGGGG + Intronic
1165048593 19:33126373-33126395 GCTGGAGGCGCAGCTGGGTCAGG + Intronic
1165067209 19:33236205-33236227 GGTGGAGGCCCAGCTGGATGTGG + Intergenic
1165446097 19:35857379-35857401 CCTGGTGGTGCTGCTGGGGGAGG + Exonic
1165658169 19:37551240-37551262 GGTGGAGGCCGTGCTGGCTGCGG - Intergenic
1165865177 19:38932580-38932602 TCTGGTGCTCCTGCAGGGTGTGG - Exonic
1166254418 19:41592232-41592254 GCTGTGGGCCCTGCTGAGGGAGG - Intronic
1166795518 19:45423322-45423344 GCTGGCGGCCCTGAGGGCTGGGG + Exonic
1166804512 19:45477326-45477348 GGTGGGGACCCTGCAGGGTGGGG + Intronic
1167247654 19:48383360-48383382 GCTGGGGCCCCTGCAGGGAGGGG + Intronic
1167469761 19:49669070-49669092 GCTGGTGGCCCTGCTGGAGGAGG + Exonic
1167522067 19:49961006-49961028 GCTGCTGCCCGTGCTGGGGGCGG - Exonic
1167523315 19:49969719-49969741 GCTGCTGCCCGTGCTGGGGGCGG + Intergenic
1167564986 19:50250529-50250551 ACTCCTGGCCCTGCTGGATGAGG + Exonic
1167785210 19:51630299-51630321 GCTGCTGCCCCTGCTGTGGGGGG - Intronic
1167787309 19:51646723-51646745 GCTGCTGCCCCTGCTGTGGGGGG - Exonic
1168289136 19:55348496-55348518 GCTGGGGGCCTGGCTGAGTGAGG + Intergenic
1168351423 19:55678330-55678352 GCTGGGGCCCCTGCTCAGTGAGG - Intronic
924998273 2:384030-384052 GCTGCCAGCCCTGCAGGGTGGGG - Intergenic
925142915 2:1562316-1562338 GCTGGACGCCCTGCAGGGAGGGG + Intergenic
925147755 2:1592248-1592270 GCAGGCTGCCCTGCTGGGAGGGG + Intergenic
925235213 2:2272045-2272067 GCTGGTGGGATTGCTGGGTGGGG - Intronic
925335382 2:3095333-3095355 GCTTGTGTCCCTGCAGTGTGGGG + Intergenic
926225840 2:10966337-10966359 CCTGGTGGCCCTGCAGGTGGAGG + Intergenic
927213708 2:20653966-20653988 GGTGGTGGCCCTGCTCCATGTGG - Intergenic
927842409 2:26454054-26454076 GGAGGTGGCACTGGTGGGTGGGG + Intronic
928308818 2:30193331-30193353 GCAGGGGGCCCTGATGAGTGTGG - Intergenic
928462178 2:31485272-31485294 CCTGGAGGACCTGCTTGGTGAGG + Intergenic
929830397 2:45342548-45342570 CCTGGGAGCCCTGCTGGGTGTGG - Intergenic
931666365 2:64612208-64612230 GCTGGGGGACCAGTTGGGTGGGG + Intergenic
931771895 2:65504491-65504513 GCTGGTGGACTTGCTGGTGGTGG - Intergenic
931966857 2:67544539-67544561 GCTGAAGGCCCAGCTGGCTGTGG - Intergenic
932407199 2:71521530-71521552 GGTGGTGGACGTGTTGGGTGAGG + Intronic
932414659 2:71566255-71566277 CCTGGTGGACTTGCTGGGAGGGG + Intronic
932416844 2:71578737-71578759 GCTGGTGGACGTGTTGGGTCAGG - Intronic
933254432 2:80064556-80064578 GCTGGTGGCTCAGCTGGGGCTGG + Intronic
933679818 2:85089789-85089811 ATTGGGGGCCCTGCTGGCTGGGG - Intergenic
934655417 2:96114722-96114744 GCTTCTTGCCCTGCTGTGTGTGG - Exonic
935332550 2:101987778-101987800 GCTGGTGGGGCTGGTGGGTCGGG + Intergenic
935708505 2:105877138-105877160 GCAGGTGGCCTTTCTGTGTGAGG - Intronic
936077575 2:109411478-109411500 GCTGGTGGCCAAGGTGGGAGGGG - Intronic
936388977 2:112055116-112055138 GCTCGGGGCCAAGCTGGGTGTGG - Intergenic
936661344 2:114547316-114547338 GCTGCTGCCCCTGCAGGGTCTGG + Intronic
936937738 2:117854171-117854193 GCTGGTGCCCCTGCTGTGACTGG - Intergenic
937064335 2:119005930-119005952 GCGGGGTGCCCTGCTAGGTGGGG - Intergenic
937877123 2:126834187-126834209 GCTGTTGGCATTGCTGTGTGTGG - Intergenic
937985161 2:127635068-127635090 GCTGGTGTACCTGCTGGGACAGG + Intronic
938324718 2:130390873-130390895 GCAGGTGGCCAGGGTGGGTGTGG - Intergenic
940446779 2:153785975-153785997 GCTTGGGGCCCTGCTCGTTGGGG - Intergenic
940446893 2:153786634-153786656 GCTTGGGGCCCTGCTTGTTGGGG - Intergenic
943435972 2:187866580-187866602 GCTGGTGTCCCTCCAGGTTGAGG - Intergenic
944471143 2:200055057-200055079 TCTGGAGGCCCTGCTCAGTGAGG - Intergenic
945293233 2:208145860-208145882 ACTGGTGGCCCTGGTAGTTGGGG + Exonic
945676247 2:212858663-212858685 GCTCCTGGCCATGCTGGGTGTGG + Intergenic
946230258 2:218286894-218286916 GCTCCTGCGCCTGCTGGGTGGGG - Intronic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
947806706 2:232973696-232973718 GCTGGTGGCTCTTCTGGGTTTGG - Intronic
948459976 2:238124328-238124350 GCATGCGGCCCTGCTGGCTGGGG + Intronic
948754868 2:240153613-240153635 GCCAGTGGCCCTGATGGGAGCGG - Intergenic
949017829 2:241723431-241723453 GCTGGTGGCTGCTCTGGGTGTGG + Intronic
1168848006 20:958630-958652 GAGGGTGGGCCTGCTGGGAGGGG + Exonic
1168970038 20:1924822-1924844 GCTGGTGGCCCTACTGATGGCGG + Exonic
1170278540 20:14619920-14619942 GCTAGTGGCCATCATGGGTGAGG + Intronic
1170924689 20:20712369-20712391 CCTGCGGGCGCTGCTGGGTGAGG - Exonic
1171102774 20:22401075-22401097 GCTGGAAGCCATGCTGTGTGCGG + Intergenic
1171119651 20:22557627-22557649 GCTGGAGCCCCTGCTGCTTGTGG - Intergenic
1171376929 20:24700121-24700143 GCTGGGGCTCCTGGTGGGTGTGG - Intergenic
1171427369 20:25057488-25057510 GCTGCTGGCCTTGCTCGGCGCGG - Intronic
1172130340 20:32650773-32650795 GCTGGTGGCTGGGCTGGGGGTGG + Intergenic
1172842278 20:37909170-37909192 GCTGCTCGCCCTCCTGGGTGTGG - Intronic
1173174596 20:40754789-40754811 GCTCCTGGCCCTGCTGGGGAGGG - Intergenic
1173544310 20:43881763-43881785 GCTGGGTGCTCTGCTGAGTGAGG + Intergenic
1173706638 20:45115038-45115060 CCTGGGGGCCCTCCTGGCTGTGG - Exonic
1174869573 20:54170694-54170716 GCTGCTGTCCCTCCTGGGAGGGG + Intronic
1175080791 20:56418687-56418709 GCTGGTCGCCGTGTCGGGTGGGG + Intronic
1175166682 20:57049049-57049071 TCTGGTGGGCCTGGTGAGTGTGG - Intergenic
1175803119 20:61812342-61812364 GCTGCTGGGCCTGCCGGGTGGGG + Intronic
1176066978 20:63203008-63203030 GCTGGGGGCTGTGCTGGGAGAGG + Exonic
1176719844 21:10384163-10384185 GCTGGAGCCTCTGGTGGGTGGGG - Intergenic
1176876108 21:14130797-14130819 CCTGGTGGCTGTGTTGGGTGGGG - Intronic
1178843269 21:36155653-36155675 GCTGGAGCCACAGCTGGGTGGGG + Intergenic
1179284467 21:39965333-39965355 GCTGGTGGGGGTGCAGGGTGTGG - Intergenic
1179460099 21:41528813-41528835 GCAGGTGCCTCTGCTGGGGGAGG + Intronic
1179720669 21:43314411-43314433 GCTGGTGGTCTTGATTGGTGTGG + Intergenic
1179831879 21:44001917-44001939 GCTTGTGTCCCTGCGCGGTGGGG - Intergenic
1179975185 21:44861440-44861462 GCTGGCCGCTGTGCTGGGTGTGG - Intronic
1179979384 21:44888403-44888425 GCTGGTGGGCCTGCCCGGTGTGG + Intronic
1180037301 21:45256470-45256492 GATGGGGGCTCTGCTGGGTCGGG + Intergenic
1180135878 21:45861402-45861424 GCTGTTGCCCCAGCTGGCTGGGG - Intronic
1180207226 21:46268527-46268549 GGTGGGGGCCCTGCTGAGGGCGG + Intronic
1180301079 22:11037124-11037146 GCTGGAGCCTCTGGTGGGTGGGG - Intergenic
1181005251 22:20010375-20010397 TCTGGTGGGCCTGGCGGGTGGGG - Intronic
1181031383 22:20150199-20150221 GCTGGGGGCCCTCCTGGGGCCGG - Exonic
1181036316 22:20171466-20171488 GCAGGTGGCACTGCTGGCTTTGG + Intergenic
1181167473 22:20991443-20991465 GCTGGTGCCCGTGCTGGATGGGG + Intronic
1181310116 22:21939986-21940008 GCTGGGGACCCTGGGGGGTGGGG + Intronic
1181511950 22:23393203-23393225 GCTGGGGGCCCTCCTGGGGCCGG + Intergenic
1181518687 22:23433054-23433076 TCTGGTGCCCCTGCTGGATCAGG + Intergenic
1181670608 22:24424033-24424055 GCTGGTGGCCGGGCGGCGTGGGG + Intronic
1181939427 22:26463955-26463977 GGTGCTGTCCCTGCTGGCTGAGG - Exonic
1182456000 22:30450930-30450952 GATGGTGGCCATGCTGGGATTGG + Intronic
1182470189 22:30543714-30543736 GCTGGTGGCCCTACTGATGGAGG + Intronic
1182577488 22:31282916-31282938 GCAGGTGGCCCTGTGGGCTGAGG - Exonic
1183157269 22:36085120-36085142 GCAGGTGTCCCTGCTGGAAGGGG - Intergenic
1183739002 22:39659816-39659838 GCTGGTGGCCATCCTGGTGGAGG + Exonic
1183742961 22:39678592-39678614 ACTGGGGGCTCTGCAGGGTGGGG - Intronic
1184035943 22:41918165-41918187 GCTGGGGGCCCTGAGAGGTGTGG + Intergenic
1184046846 22:41977137-41977159 GCTGGAGGCGCTCCTGGGGGAGG + Intronic
1184171708 22:42764057-42764079 GGAGGTGGCCCTGCAGGCTGGGG + Intergenic
1184198144 22:42945916-42945938 CCTGGAGGCCCTGCTGGCTTCGG - Intronic
1184203643 22:42986455-42986477 GCTGGTTGCCATGCTGGGAAGGG - Intronic
1184649188 22:45911843-45911865 GCGGGAGGCTCTGCGGGGTGGGG + Intergenic
1184787679 22:46679835-46679857 GTTGGTGGCCCAGCTGGCTCAGG - Intergenic
1185326268 22:50227304-50227326 GAGGGAGGGCCTGCTGGGTGTGG - Intronic
949684575 3:6553474-6553496 GCTGGTGTCCCTGGCAGGTGGGG + Intergenic
950408111 3:12817056-12817078 GCATGTGGCCCAGCTGGCTGTGG + Exonic
950437227 3:12987202-12987224 GCAGCTGGTCCTGCTGGGGGCGG + Intronic
950504934 3:13388822-13388844 GCTGCTGGCCCTGCTGTGACTGG - Intronic
951578597 3:24138385-24138407 GATGGTGGCAGTGCGGGGTGTGG + Intronic
952883961 3:38001689-38001711 CCTGGTGGCCCTGCAGGTGGGGG - Exonic
952902937 3:38121627-38121649 GGTGGTGCCCCTGCGGGCTGTGG + Exonic
954110998 3:48432995-48433017 CCTGGGGGCCCTGATTGGTGTGG - Exonic
954140362 3:48601857-48601879 GCTGCTGGCCCTGCAGGGGGTGG + Intronic
954360220 3:50118239-50118261 GTGGGTGGTCCTGCTGGGTAAGG + Intronic
954577355 3:51683999-51684021 GCTGGTGGCCCTGGGGCGTGGGG + Intronic
954637723 3:52080377-52080399 GCAGGTGCTGCTGCTGGGTGAGG - Intronic
954864628 3:53718295-53718317 GCTGGTGGGCATGCTAGCTGTGG - Exonic
955995563 3:64677134-64677156 GCTTGTGCCCCTGGTGTGTGGGG + Intronic
956751841 3:72349668-72349690 TCTGGAGACTCTGCTGGGTGGGG - Intergenic
956892218 3:73624213-73624235 GCTGGTGGCCCAGCTGGCCGCGG - Exonic
957118317 3:76055912-76055934 GCTGGTGGTCCAGCCAGGTGTGG - Intronic
958627595 3:96646208-96646230 GCTGGTTGCACTGCTGGCTCAGG + Intergenic
959717926 3:109453671-109453693 GCTGGTGACACTGCTGCTTGTGG + Intergenic
960277209 3:115742068-115742090 GATGGAGGCCCTGCAGGGAGAGG - Intergenic
961368332 3:126415196-126415218 TTTGGTGACCCTGTTGGGTGTGG - Intronic
961368374 3:126415328-126415350 GTGGGAGACCCTGCTGGGTGGGG - Intronic
961552251 3:127676149-127676171 TGCGGTGGCCCTGGTGGGTGTGG + Intronic
961603275 3:128076558-128076580 GCTGGTGGACCTGGTGGCTGAGG + Intronic
961815374 3:129547479-129547501 GCTGGAGGCGCTGCAGGCTGGGG + Exonic
962318011 3:134370848-134370870 GTGGGGGGCCCTGCTGGTTGCGG + Exonic
963602809 3:147392275-147392297 CCTGGTGGCCCTCCGGGCTGCGG - Intronic
963733386 3:148992788-148992810 GCTGGTGGCCCTTCGGGGGTGGG + Intronic
966232522 3:177667026-177667048 GCTGGTGGCTGAGCTTGGTGAGG + Intergenic
966441099 3:179945317-179945339 GCTGGTGTCCCTACTGAGAGAGG + Intronic
966639755 3:182176754-182176776 GCATGAGGCCCTTCTGGGTGTGG + Intergenic
966865610 3:184257672-184257694 GCTGGATGCCCTGCTGGCTGGGG + Exonic
968451443 4:677809-677831 GCTGGGGGCCTTGCGGGGTGAGG + Intronic
968478593 4:824315-824337 GCTGGGGGCGCTGCTGGGCACGG + Intronic
968540226 4:1164578-1164600 GCTGCTGGGCCTACAGGGTGAGG - Intergenic
968949566 4:3683550-3683572 GCTGGTGGCCCTCCCAGCTGCGG + Intergenic
969183113 4:5456902-5456924 GATGGTGGCCCTGCTGAGGAAGG + Exonic
969196631 4:5568517-5568539 GCTGCTGGCCCTGCTGGATTCGG - Exonic
969202702 4:5618406-5618428 GCTGCTGGCCCTACAGGGTCTGG - Intronic
969620540 4:8276687-8276709 GGCTGTGGCCCAGCTGGGTGTGG + Intronic
970533127 4:17002712-17002734 GTTGGTGGCTGAGCTGGGTGAGG - Intergenic
972371172 4:38424723-38424745 GCTGCTGGCCCTGCTGGGGAGGG - Intergenic
977240333 4:94560761-94560783 GCTGTTGCCCAGGCTGGGTGTGG + Intronic
981171992 4:141636364-141636386 GCTGGTGTTCCTGCAGGGCGGGG + Intergenic
984916192 4:184726956-184726978 GGTGGTGGTCCTGGGGGGTGGGG + Intronic
985580338 5:692707-692729 GCTGGAGGCTCTGCGGGGGGCGG + Intronic
985594996 5:784088-784110 GCTGGAGGCTCTGCGGGGGGCGG + Intergenic
985831919 5:2240273-2240295 ACAGGTGGGTCTGCTGGGTGTGG - Intergenic
986826303 5:11526499-11526521 GGTGCTGGCCCAGCTGGCTGAGG + Intronic
987361654 5:17112604-17112626 GCAGGTTGCCCTGCTGGCTGGGG - Intronic
988555146 5:32229954-32229976 CCTGGGGGGCCTGCTGGCTGTGG + Exonic
994428257 5:99622453-99622475 GGTGGTTCCTCTGCTGGGTGGGG - Intergenic
994719772 5:103367121-103367143 GCTGGTGGTGCAGCTGTGTGTGG - Intergenic
997456882 5:134024236-134024258 ACTGGTGGCCAGGCCGGGTGCGG + Intergenic
997690777 5:135826127-135826149 CCTGCTGGCTCTGCTGGGTAAGG - Intergenic
997746729 5:136305846-136305868 GTTGGTGGCTGTGCTTGGTGAGG - Intronic
999268092 5:150280021-150280043 GCTGGTAGCCAAGCTGAGTGAGG - Intronic
999987961 5:157022704-157022726 GCTGGTGGCCCTGCGGAGGAAGG + Intergenic
1000031042 5:157401676-157401698 GCTGGTGGCCCTGCTACTGGGGG - Intronic
1000068676 5:157719279-157719301 GCTGGTGTCCCTGCCAGGTGGGG - Intergenic
1001433674 5:171683048-171683070 GCTGGAGGCTATGGTGGGTGTGG + Intergenic
1002053901 5:176587541-176587563 GGTGGTGGCCATGCCGTGTGGGG + Intronic
1002054420 5:176590473-176590495 GCTGGTGGTGCTGGTGAGTGCGG + Exonic
1002101008 5:176857620-176857642 GCTGGTGCCCCTGCTCGGCAAGG - Intronic
1002653741 5:180724775-180724797 GCTGGTGATGCTGCTGGTTGGGG + Intergenic
1002927953 6:1615446-1615468 GCTGGGGGCCCTGCCGAGTCTGG + Intergenic
1003308117 6:4946901-4946923 GGTGGGGGCCCTGCTGAGTGAGG - Intronic
1003324419 6:5081929-5081951 GCTGGTGGGGCTTCTGGGTGGGG + Intergenic
1004190872 6:13462387-13462409 CCTTGTGGCTCTGATGGGTGGGG - Intronic
1005852584 6:29832879-29832901 GCAGGTTGCCCTGGAGGGTGTGG + Intergenic
1005876178 6:30011402-30011424 GCAGGTAGCCCTGAAGGGTGTGG + Intergenic
1006314679 6:33283290-33283312 GCTGGTGGCCAAGCTGGATGTGG + Intronic
1006908601 6:37549361-37549383 GCTGGTGCTTCTGCTGGGAGTGG + Intergenic
1007099490 6:39235648-39235670 GGTGGTGGCCATGGTGGGAGCGG + Intergenic
1007389051 6:41539406-41539428 GCTGCTGGCACTGGAGGGTGAGG - Intergenic
1007702206 6:43771868-43771890 GCAGGTGGCCCAGCAGGGAGGGG - Intronic
1008219916 6:48843086-48843108 GCTGGCAGCCCTGCTTGTTGAGG + Intergenic
1008514325 6:52305295-52305317 GCTGGTGTCCATCCTAGGTGGGG + Intergenic
1010590977 6:77711616-77711638 GCTGCTGGCACAGCTGGGTTTGG + Intronic
1011623930 6:89268387-89268409 GGAGGTGGCCCTGCTGGCTGAGG - Intronic
1012022345 6:93939946-93939968 GCTGGTGGCCCTGATGGTTTAGG + Intergenic
1012551458 6:100467621-100467643 GCTGTTCGCCCTGCTTGGTGGGG - Intergenic
1013893626 6:115057400-115057422 GCTGAGGGCCCTGCAGGTTGTGG - Intergenic
1015943332 6:138474137-138474159 GCTGGCGGCTCTCATGGGTGGGG + Intronic
1018325946 6:162668904-162668926 GGTGGTGGCCCTGGTGGTGGTGG + Intronic
1018901526 6:168054142-168054164 GCAGCTCTCCCTGCTGGGTGGGG - Intergenic
1018907947 6:168086098-168086120 GCTGGCGTCCCTGCTGGGGATGG - Intergenic
1018923990 6:168194131-168194153 CCAGGTGGCCCTGCAGGGAGGGG + Intergenic
1019210075 6:170397803-170397825 GCTGTTGGCCCCTCTAGGTGAGG + Intronic
1019324849 7:432997-433019 TCTGGTGGCCCTGCAGGGAGGGG - Intergenic
1019339527 7:502365-502387 TCTGCTGGCCCTGCTGCCTGGGG - Intronic
1019383153 7:738855-738877 ACAGGTGGCCGTCCTGGGTGGGG + Intronic
1019447378 7:1078458-1078480 GCTGGGGTCCCTGCTTGCTGTGG - Intronic
1019524559 7:1474893-1474915 GCTGGCGGCCAGGCTGAGTGTGG - Intronic
1019565227 7:1675686-1675708 GCAGGAGGCCCTGCAGGGAGAGG + Intergenic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019599875 7:1875889-1875911 TCTGGTGCCCCTGCTGGATCAGG - Intronic
1019606782 7:1913959-1913981 GCTGGACGCCATGCTGGGGGGGG + Intronic
1019738033 7:2660058-2660080 GCGGGTGGCCGTGCGGGATGGGG - Intronic
1020126112 7:5533265-5533287 CCTGGAGGCCTTGCAGGGTGGGG - Intronic
1020279437 7:6642903-6642925 GCTCCTGGCCCTGCAGGCTGGGG + Intronic
1022355088 7:29607022-29607044 GCTGCTGGCACAGATGGGTGGGG + Intergenic
1022474692 7:30702121-30702143 GCTGGGAGCCTGGCTGGGTGGGG + Intronic
1022518346 7:30989548-30989570 GCCCGTGGCTCTGCTGGGCGTGG - Intronic
1022734569 7:33063447-33063469 GCTGGTGGTGCTGCCTGGTGGGG + Intergenic
1022741920 7:33129817-33129839 GCTGGTGGTGCTGCCTGGTGGGG + Exonic
1022793594 7:33714298-33714320 GCTGGTGCCGCTGCTGGGTGTGG - Intergenic
1023965977 7:44963238-44963260 GCTGGTGGCCCTGGCGAGGGCGG - Intronic
1024044504 7:45577631-45577653 GGTAGTAGCCATGCTGGGTGTGG + Intronic
1024251677 7:47510175-47510197 GCTTGTGGGCCTGCTGGCTATGG - Intronic
1025614644 7:63107149-63107171 GCTGGTTGTGCTGCTGCGTGTGG + Intergenic
1025739197 7:64182617-64182639 GCTGGGGGAGCTGCTGGCTGAGG + Intronic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1027050370 7:75017938-75017960 CCTGGTGGCCCTGGGGGATGTGG - Intronic
1027059427 7:75073710-75073732 GCTGGTGGCGTTGGTGGCTGGGG - Exonic
1029259493 7:99292251-99292273 AGTGGTGGCCCTGCGGGCTGTGG + Intergenic
1029488376 7:100856938-100856960 GCTGCTGGGCCTTGTGGGTGGGG + Exonic
1030533325 7:110736429-110736451 GCTGGTGGCTCTGCTGGTCCAGG - Intronic
1032744750 7:134774359-134774381 CCTGGGAGCCCTGCAGGGTGAGG + Intronic
1032819313 7:135510057-135510079 GATGGTGGCCCGTCTGGCTGTGG - Exonic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1034283697 7:149870746-149870768 GCTGGGAGTCTTGCTGGGTGAGG - Intergenic
1034348645 7:150402721-150402743 GGTGGTTGCCCTGCTGAGTGAGG + Intronic
1034356155 7:150451892-150451914 GATGGTTGCCCTGCTGGGCTGGG + Intronic
1034400465 7:150858430-150858452 CCTGGTGGCCTTGTTGGGTCTGG - Intronic
1034424932 7:151009388-151009410 GATGGTGGCCCTCCTGGGGGTGG - Exonic
1034970156 7:155413667-155413689 GCTGGGAGCCCACCTGGGTGGGG + Intergenic
1035170855 7:157016787-157016809 GCTGGGGGCCCGCCTGGGAGGGG + Intergenic
1035237396 7:157507687-157507709 CCTGCTGACCCTGCAGGGTGTGG + Intergenic
1035272686 7:157729781-157729803 GCAGGTGGCCCTTATGGGTGTGG - Intronic
1035394673 7:158527223-158527245 GCTGGTGGAGAAGCTGGGTGTGG - Intronic
1035413294 7:158663447-158663469 GCTGGTGGCCCATCACGGTGTGG + Intronic
1035635770 8:1143067-1143089 GCTGGTGGCCCCGCTGTGGCCGG - Intergenic
1036225130 8:6951545-6951567 CCTGGTGGCCCTGCAGGCTCGGG - Intergenic
1036256470 8:7210541-7210563 GCTGGGGGCACTGTGGGGTGAGG + Intergenic
1036308520 8:7669126-7669148 GCTGGGGGCACTGTGGGGTGAGG + Intergenic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1037987287 8:23297927-23297949 GGTGGGGGCCGGGCTGGGTGAGG + Exonic
1037993817 8:23338926-23338948 CCTGCAGGCTCTGCTGGGTGTGG + Intronic
1038843086 8:31204387-31204409 GGTGGCTGCCGTGCTGGGTGCGG + Intergenic
1039777402 8:40750745-40750767 TCTGATGGCCCACCTGGGTGTGG - Intronic
1040410895 8:47153184-47153206 GGTGGTAGCCCTGCTTGGGGAGG + Intergenic
1040581144 8:48699637-48699659 GCAGGTGGGCCTGCTAGGAGCGG - Intergenic
1043160506 8:76840855-76840877 GCTGGTGGCCAAGCTGGATTTGG - Intronic
1043519431 8:81027999-81028021 GCTGTTGGGGCTGCTGGGTGTGG + Intronic
1048457401 8:134590773-134590795 GATGGTGGCAGTGCTGGTTGTGG - Intronic
1048955445 8:139532318-139532340 ACAGGTGGCACTGCTGAGTGGGG + Intergenic
1049063406 8:140294215-140294237 GCTGGTGGGCCTGGGAGGTGGGG - Intronic
1049093482 8:140534331-140534353 CCAGGAGGCCCTGGTGGGTGAGG + Intronic
1049300370 8:141866574-141866596 GCTGGTGGCCCAGGAGGCTGGGG - Intergenic
1049376418 8:142291535-142291557 GTGGGTGGCAGTGCTGGGTGGGG - Intronic
1049431951 8:142569380-142569402 GCTGGTGGAGCTGCCGGGCGAGG - Intergenic
1049493489 8:142917227-142917249 GCAGGAGGCCCTGCTGGACGGGG + Intronic
1049509620 8:143020963-143020985 GCTGGCTGCCCTTCTGGGTGTGG + Exonic
1049514295 8:143045287-143045309 GCTGGTGGCCCTGCTGAGCATGG - Intronic
1049639343 8:143707603-143707625 GCTGGTGGCCGGGCCGGGGGCGG - Intronic
1049658542 8:143809503-143809525 GAGGCTGGGCCTGCTGGGTGGGG - Intronic
1049678421 8:143903966-143903988 GCTGCGGGCCCTGCTGGGTGAGG - Intergenic
1049814190 8:144590552-144590574 GCTGGTGGTTCTGCAGGCTGTGG - Intronic
1050462922 9:5892564-5892586 ACTGGAAGCCCTGCTGGGTCTGG - Intronic
1050607667 9:7318098-7318120 GGTGATGGCCTGGCTGGGTGAGG - Intergenic
1052378220 9:27741663-27741685 CCCGGAGGCCCTGCTTGGTGAGG + Intergenic
1052534733 9:29732353-29732375 GGCAGTGGCCCTGCTGGTTGTGG + Intergenic
1053001603 9:34579823-34579845 GCTGGAGGTGCTGCTGGGGGAGG + Intronic
1053121121 9:35548128-35548150 GGAGGTGACCCTCCTGGGTGGGG - Exonic
1053131898 9:35620047-35620069 GCTGGTGGCAGGGGTGGGTGGGG + Intronic
1053201114 9:36152049-36152071 GCTGCCCGCCCTTCTGGGTGGGG + Intronic
1053509151 9:38672568-38672590 GCAGCTGGCTCTGCTGGGTGTGG - Intergenic
1054769213 9:69068553-69068575 GCTGCTGGCCCTCCTGTGGGCGG + Intronic
1055466782 9:76574182-76574204 CCTGGAGACCCTGCTGGGTAAGG - Intergenic
1056771970 9:89484149-89484171 GCAGGTGGGCCTGCAGGGCGGGG - Intronic
1057276105 9:93676742-93676764 GCTGCTGGCCGTGCTGGTGGAGG - Exonic
1057570781 9:96202838-96202860 GCTGGTGGATCTGATGGGAGAGG + Intergenic
1058005138 9:99906575-99906597 CCTGGGGGCCCTGCGGGGCGGGG + Intergenic
1058743802 9:107969886-107969908 ACAGGTGCTCCTGCTGGGTGTGG + Intergenic
1058775593 9:108280155-108280177 GATGGTGGCTCTGATGAGTGTGG + Intergenic
1060773385 9:126349018-126349040 CCAGGTGGCCCTACAGGGTGTGG - Intronic
1060814499 9:126627508-126627530 GCTGGGAGCCCTGCTTGGTCAGG + Intronic
1060815470 9:126632848-126632870 GCTAAGGGCCCTTCTGGGTGTGG - Intronic
1061091516 9:128429033-128429055 GCTGGTGAGCCTGCCTGGTGGGG + Exonic
1061119076 9:128632246-128632268 GCTGGTCCCACTGCTGGGCGAGG - Exonic
1061280162 9:129593417-129593439 GCTGGTAGCTGTACTGGGTGAGG + Intergenic
1061503993 9:131020305-131020327 GCTCTTGGCACTTCTGGGTGTGG + Intronic
1061536857 9:131255671-131255693 GCTGATGGCCTGGCGGGGTGCGG - Intergenic
1061546510 9:131307878-131307900 GCTGGTGGCCCTGATGGCCCAGG + Intronic
1061757367 9:132824403-132824425 GGTGGGTGCCGTGCTGGGTGAGG + Intronic
1062098591 9:134716043-134716065 GCTGGTAGCACTGCTGGTGGTGG + Intronic
1062352896 9:136147904-136147926 CCTGGAGGCCCAGCAGGGTGGGG - Intergenic
1062444702 9:136588724-136588746 CCTAGAGGCCCTGCTGTGTGTGG + Intergenic
1062457222 9:136645498-136645520 GGTCGTGGCCCTGCTGTGAGAGG - Intergenic
1062521883 9:136961392-136961414 CCTGCAGGCCCTGGTGGGTGGGG - Intergenic
1062539596 9:137035694-137035716 CCAGGTGGAGCTGCTGGGTGGGG + Exonic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185960360 X:4541666-4541688 GCTGGTGGCTGAGCTTGGTGAGG + Intergenic
1186784416 X:12944366-12944388 GCTGGTGGCTGAGCTTGGTGAGG - Intergenic
1187962738 X:24582095-24582117 GCAGGAGGCTCTGGTGGGTGGGG + Intronic
1190077799 X:47331033-47331055 TCTGGTGGCTAGGCTGGGTGTGG - Intergenic
1190108442 X:47574510-47574532 GCTGCTGGCCCTGCGGGGGCGGG + Exonic
1192430999 X:71111476-71111498 GCAGCTGCCCCTGCTGGGAGTGG - Exonic
1193607236 X:83583666-83583688 GCTGGAGGCTCTGCTTGTTGGGG - Intergenic
1194234994 X:91372295-91372317 GCTGATGGCTCTGCTTGTTGAGG - Intergenic
1194467965 X:94256164-94256186 GCTGCAGGCCCTGCTTGGTGAGG - Intergenic
1195094785 X:101492802-101492824 GCTGGTGGCCAGGCTGGTGGAGG + Exonic
1197705615 X:129632521-129632543 GCTGGTGGGCCTGGTGGGTGTGG - Intergenic
1198369171 X:135974188-135974210 GGGGGGGGCCCTGGTGGGTGCGG + Intergenic
1198983382 X:142424530-142424552 GTTGGTGGCTGAGCTGGGTGAGG + Intergenic
1199908319 X:152258841-152258863 ATTGGTGTCCCTGCTGAGTGGGG - Intronic
1201516061 Y:14819592-14819614 GCTTGTTCCCCTTCTGGGTGGGG + Intronic