ID: 1036743531

View in Genome Browser
Species Human (GRCh38)
Location 8:11388467-11388489
Sequence GCTAAAGGATGTCCACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036743525_1036743531 4 Left 1036743525 8:11388440-11388462 CCACCCCAAAGGATAAAGAACCA No data
Right 1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG No data
1036743523_1036743531 9 Left 1036743523 8:11388435-11388457 CCCTTCCACCCCAAAGGATAAAG No data
Right 1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG No data
1036743522_1036743531 10 Left 1036743522 8:11388434-11388456 CCCCTTCCACCCCAAAGGATAAA No data
Right 1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG No data
1036743524_1036743531 8 Left 1036743524 8:11388436-11388458 CCTTCCACCCCAAAGGATAAAGA No data
Right 1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG No data
1036743528_1036743531 -1 Left 1036743528 8:11388445-11388467 CCAAAGGATAAAGAACCACGATG No data
Right 1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG No data
1036743526_1036743531 1 Left 1036743526 8:11388443-11388465 CCCCAAAGGATAAAGAACCACGA No data
Right 1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG No data
1036743527_1036743531 0 Left 1036743527 8:11388444-11388466 CCCAAAGGATAAAGAACCACGAT No data
Right 1036743531 8:11388467-11388489 GCTAAAGGATGTCCACCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036743531 Original CRISPR GCTAAAGGATGTCCACCTAA AGG Intergenic
No off target data available for this crispr