ID: 1036744064

View in Genome Browser
Species Human (GRCh38)
Location 8:11391512-11391534
Sequence AAGGAGTTCCAGAAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 567}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036744064_1036744073 13 Left 1036744064 8:11391512-11391534 CCGTCCTCCTTCTGGAACTCCTT 0: 1
1: 0
2: 7
3: 58
4: 567
Right 1036744073 8:11391548-11391570 CTGGAGTGAGGCTGAGGAATGGG No data
1036744064_1036744070 1 Left 1036744064 8:11391512-11391534 CCGTCCTCCTTCTGGAACTCCTT 0: 1
1: 0
2: 7
3: 58
4: 567
Right 1036744070 8:11391536-11391558 CTGACAAGTCGTCTGGAGTGAGG No data
1036744064_1036744067 -6 Left 1036744064 8:11391512-11391534 CCGTCCTCCTTCTGGAACTCCTT 0: 1
1: 0
2: 7
3: 58
4: 567
Right 1036744067 8:11391529-11391551 CTCCTTCCTGACAAGTCGTCTGG No data
1036744064_1036744071 7 Left 1036744064 8:11391512-11391534 CCGTCCTCCTTCTGGAACTCCTT 0: 1
1: 0
2: 7
3: 58
4: 567
Right 1036744071 8:11391542-11391564 AGTCGTCTGGAGTGAGGCTGAGG No data
1036744064_1036744072 12 Left 1036744064 8:11391512-11391534 CCGTCCTCCTTCTGGAACTCCTT 0: 1
1: 0
2: 7
3: 58
4: 567
Right 1036744072 8:11391547-11391569 TCTGGAGTGAGGCTGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036744064 Original CRISPR AAGGAGTTCCAGAAGGAGGA CGG (reversed) Intronic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
901688848 1:10959704-10959726 AAGGGCTTCCAGAAGCAGAAAGG + Intronic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902909209 1:19582762-19582784 ATGGGGTTCAAGTAGGAGGAAGG - Intergenic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903438726 1:23371197-23371219 AAGCACTTACAGAAGGAGGCAGG - Exonic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
904859669 1:33526177-33526199 AAGGAGTGACAGAAGAAGGGAGG + Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905627458 1:39498269-39498291 AAGAGGTTCCAGGAGGAGGGGGG - Intronic
905875229 1:41427908-41427930 AAGGAGTGAGAGGAGGAGGACGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907517525 1:55002021-55002043 AAAGACATCCAGAAGAAGGAAGG + Intronic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907927209 1:58966051-58966073 AAGGAGTTCAGGAAGGAGGGAGG - Intergenic
908134935 1:61121915-61121937 AAGCTATTCCAGAAGGAGGCTGG + Intronic
908239776 1:62179028-62179050 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561873 1:77016301-77016323 GAAGAGTTTCAGGAGGAGGAGGG - Intronic
909969489 1:81962869-81962891 AAGCAGTTCCTTAAGGAGCAAGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910644662 1:89500534-89500556 AAGGAGTTCCAGGAATAGGCAGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911664538 1:100538784-100538806 AGGGAGCTCGAGGAGGAGGACGG - Intronic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
912767898 1:112432978-112433000 AAGAAGTTTAACAAGGAGGATGG - Intronic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
915514659 1:156405851-156405873 GAAGAGTTTCAGAAAGAGGAGGG + Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915732015 1:158060554-158060576 AGGGAGTTAAAGGAGGAGGAAGG - Intronic
915855125 1:159375273-159375295 TGGGAGTTCCAGAAGGAAAATGG + Intergenic
915896268 1:159813557-159813579 AAGGACTTCCAGCAGGATGGTGG + Intronic
916997443 1:170316003-170316025 AAGGAGCTCTGGAAGGAAGAGGG - Intergenic
917393092 1:174560718-174560740 AAGGACTACTAGAAGGGGGAGGG - Intronic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
918111734 1:181460618-181460640 ATGGAGTTCCCTCAGGAGGAAGG + Intronic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920274682 1:204795358-204795380 GAGGAGTTCTAGAAGGAAGAAGG + Intergenic
920299107 1:204977610-204977632 AAGGTGTTCTAGAAGGATGGGGG - Intronic
920885227 1:209921004-209921026 AAGGAGTTTCAGAAAGAAAAAGG - Intergenic
921658448 1:217769259-217769281 AATGTGTTCCAGAATGAAGATGG + Intronic
922133409 1:222801386-222801408 AAGGAGTTTGATGAGGAGGAGGG + Intergenic
922821188 1:228486999-228487021 CAGGAGTTACTGAAGTAGGAAGG + Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
924071551 1:240285419-240285441 GAGGAGTTCAGGAAGGAGGTCGG + Intronic
924888618 1:248248473-248248495 AGGGAGTGACAGAGGGAGGAAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1064432482 10:15283129-15283151 AGGGAGTTACAGAGGGAGGGAGG + Intronic
1064961908 10:20974452-20974474 CAGGAGTTCGAGAAGCAGCATGG - Intronic
1065386895 10:25142921-25142943 AAGGGGTTCCAAAAGGAAGTAGG + Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1068282016 10:54885250-54885272 AAGGGCTTCAAGAAGGGGGAAGG + Intronic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069349931 10:67513201-67513223 AAGGAGTACCAGAATGGGTATGG - Intronic
1069599306 10:69693122-69693144 AAGGAGTTGCAGAAGGTAAAGGG - Intergenic
1069664031 10:70143185-70143207 TAGGAGTTCCAGGAGGAGATGGG - Intronic
1070731594 10:78832204-78832226 AAGGAGTTCCACAAGGCCAAAGG + Intergenic
1071020166 10:81044623-81044645 AGGGACTACCAGAAGGTGGAGGG - Intergenic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071153493 10:82663497-82663519 AAGGAGTTAGCAAAGGAGGAAGG + Intronic
1071529251 10:86376776-86376798 AGGGAGTTGAATAAGGAGGAAGG + Intergenic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1072809179 10:98446383-98446405 AAGGAGCTCCAGATGGCGGGGGG + Intronic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074717918 10:116236680-116236702 ATGGAGTTGAAGAAGGAGAATGG + Intronic
1074750867 10:116585902-116585924 GTAGAGTTCCAGAAGGAGCATGG - Intergenic
1074931199 10:118127939-118127961 AAGAAGTGACAGATGGAGGAAGG - Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075781509 10:125020410-125020432 AAGCAGTTCCACATGGAGTAGGG - Intronic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078744071 11:14094706-14094728 AAGCAGTTACAAAATGAGGAAGG + Intronic
1079082246 11:17421898-17421920 AAGGAGTTCCAGGAGGCACAAGG - Intronic
1079270851 11:18984377-18984399 TAAGAGTTGCAGAAGGATGAAGG - Intergenic
1079321854 11:19457944-19457966 AAGGAGTTAGAGAAGAAAGATGG + Intronic
1079875049 11:25845856-25845878 AAGGAGGTTCAAGAGGAGGATGG - Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1081549578 11:44098835-44098857 AAGGAATTTCCAAAGGAGGAGGG - Intronic
1082693043 11:56328405-56328427 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082999870 11:59281430-59281452 ACTTAGTTCCAGAGGGAGGAAGG + Intergenic
1083492200 11:63021328-63021350 AAGGGATTCCAGAAGGTGGGAGG - Intergenic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084162202 11:67356027-67356049 AAGAAGGTACAGAAGGTGGATGG - Intronic
1084452868 11:69250497-69250519 AATGAGTTCCAGAAGTCGGCTGG - Intergenic
1085371498 11:76010915-76010937 AGGGACTTCAAGAAGCAGGATGG + Intronic
1085790390 11:79492731-79492753 AAACAGTTACAGAGGGAGGATGG + Intergenic
1086593110 11:88539715-88539737 AAGTAGGTCCAGATGGAGGTAGG - Intronic
1086901699 11:92374796-92374818 ATGGAATTTCAGAAGGAAGATGG - Intronic
1087271294 11:96114694-96114716 AAGGAGTTCAGAAAGGAGGGAGG - Intronic
1088572589 11:111237758-111237780 AAGGGGTTCAGAAAGGAGGAAGG - Intergenic
1088988101 11:114927664-114927686 AAGGAGGTCGAGAGAGAGGAAGG + Intergenic
1089280188 11:117368669-117368691 AAGGACTCCAAGAAGGAGGTGGG - Intronic
1089295628 11:117465529-117465551 AAGGAGTGCCAGAGAGAGGCAGG - Intronic
1089324090 11:117645242-117645264 AACGAGTTCCAGAGAGAGAAAGG + Intronic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1089862694 11:121604222-121604244 AGGGAGTTCCAGTGCGAGGACGG + Exonic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1091294148 11:134460912-134460934 AAGGCCTTCCAGAAGCACGAAGG + Intergenic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091983590 12:4887210-4887232 ATATAGTTCCAGAAGGAGCAGGG + Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093348768 12:18071223-18071245 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1096111323 12:49030933-49030955 AAGAAGCTGCGGAAGGAGGACGG - Exonic
1096197063 12:49655603-49655625 AAGGAGGGAAAGAAGGAGGAAGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096716183 12:53492998-53493020 AAGGAGGTCGGGAAGGGGGAGGG - Intronic
1096980555 12:55726116-55726138 AAGGCGATCCATAAGGAGGTAGG - Exonic
1098080295 12:66777318-66777340 AGGGTGTTCCAAGAGGAGGAGGG - Intronic
1098610805 12:72455071-72455093 AAGAAGGTCAGGAAGGAGGAAGG + Intronic
1099133213 12:78862802-78862824 AAGAAGTTGGAGGAGGAGGAAGG - Intergenic
1099862481 12:88237637-88237659 CAGGAGTTCAATAAGGAGAAGGG - Intergenic
1100510082 12:95262046-95262068 AAGGAGTTGGAGAAGTGGGATGG - Intronic
1101427631 12:104600898-104600920 AAGGAAGCCGAGAAGGAGGAAGG - Intronic
1101576403 12:106001091-106001113 AAGGAGTGCAAGCAGGAAGAAGG + Intergenic
1103798757 12:123523494-123523516 GAGGAGTTCCAGAAGCATGAAGG - Exonic
1103963553 12:124624011-124624033 AAGGAGTTCTAAACAGAGGAGGG - Intergenic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1105442875 13:20429992-20430014 GAGGAGTTCGGGGAGGAGGAGGG - Intronic
1105841327 13:24255734-24255756 AAGGAGTTCCAGGACTGGGATGG - Intronic
1105914113 13:24896274-24896296 AATGAGTTCCTGAAGAGGGACGG + Intronic
1105945226 13:25183905-25183927 AAGAAGTTGTGGAAGGAGGAGGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1107235403 13:38162559-38162581 AACGAGTTGCAGAAGGGTGATGG - Intergenic
1107390054 13:39954303-39954325 AGGAAGTTTTAGAAGGAGGATGG - Intergenic
1108135261 13:47350199-47350221 AAGCAGTGCCATAAGCAGGAAGG + Intergenic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1108708239 13:53009256-53009278 AAGAAGTTCCAGCAGGAGAAGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109663915 13:65504722-65504744 GAAGAGTTCCAGAAGGAGATGGG - Intergenic
1109690758 13:65885035-65885057 AAGGACTTCCAGAAGGGCAAAGG + Intergenic
1111337045 13:86838563-86838585 AAGGAGTGCGTGAATGAGGATGG + Intergenic
1111436437 13:88215931-88215953 GAGTAGTTTGAGAAGGAGGAAGG + Intergenic
1111806398 13:93044116-93044138 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1112114783 13:96339902-96339924 AATTATTTCCAGAAGGAGGTGGG + Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113270287 13:108666029-108666051 AAGGCTTTTCAGAAGCAGGAAGG + Exonic
1114411525 14:22505029-22505051 AATAAGTTAAAGAAGGAGGAAGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1114971171 14:28030483-28030505 AAGGAGTTCCAGAGGGGTGAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1116802679 14:49459582-49459604 AAGGATCTCCAGCAGGATGAGGG + Intergenic
1117821371 14:59652959-59652981 TAGGAGTTCCAGAAAGAGAGAGG + Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118721804 14:68599824-68599846 AAGTGGTTCCGAAAGGAGGAAGG - Intronic
1119414217 14:74458884-74458906 AGGGAGTTCCAGAGGGTGCAGGG - Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120286100 14:82504005-82504027 CAGGAGTTCCAGGAGGTGAAAGG - Intergenic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1121682638 14:95806673-95806695 TAGGAATCCCAGAAGGAGAATGG - Intergenic
1121743691 14:96271311-96271333 AAGGAGTTCCAGAAGGAAAGGGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1122301214 14:100732143-100732165 AAGGACTGCCAGAAAAAGGACGG + Exonic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124075196 15:26437668-26437690 AATCAGTCCCAGAAGGACGATGG - Intergenic
1125920503 15:43522755-43522777 AAAGAGCTCAAGAAGGATGAAGG + Exonic
1126131539 15:45346765-45346787 AACGGGTTCCAGTAGGAAGAAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127041835 15:54985323-54985345 ATGATGTTCCAGAAGGAGGCAGG - Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128431416 15:67598511-67598533 AAGGAGTGCAGGGAGGAGGAGGG - Intronic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1130209800 15:81912550-81912572 AAGGAGGTCAGGAAGGAGGGAGG - Intergenic
1130857939 15:87857842-87857864 AAGGACTTCCTGAAGAAAGATGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131303677 15:91222168-91222190 AAGGGGTTCCAAAGGAAGGAGGG - Intronic
1131465597 15:92652796-92652818 AAGGAGTTGCAGAGGGAGAAAGG + Intronic
1131631022 15:94176847-94176869 AAGGAATTCCTGAAATAGGAGGG - Intergenic
1131799533 15:96054516-96054538 AAGCAGTTCCAGTAGGTGAAGGG + Intergenic
1132221397 15:100108153-100108175 AAGGAATGCGAGAAGAAGGAAGG - Intronic
1132557787 16:580023-580045 AAGCAGTCCCAGTAGCAGGAGGG - Intronic
1132603876 16:785651-785673 AAGCTGTTCCAGGAGGAGGGAGG + Exonic
1132758210 16:1496219-1496241 AGGGAGTTTCAGAACGAGGTCGG - Intronic
1132793413 16:1706343-1706365 ATGGAGATCCAGATGGACGAGGG + Exonic
1133088905 16:3388328-3388350 AAAGACTTGCTGAAGGAGGAGGG - Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1134617337 16:15661738-15661760 AAAGACTTCCAGAAGGTGGCTGG - Intronic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135637934 16:24094938-24094960 AAGGAGGGACAGAAGGAGGGAGG + Intronic
1136000348 16:27287785-27287807 AGGGACTTCTAGAGGGAGGATGG + Intronic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137416794 16:48289657-48289679 AAGAAGTTCCATAAGGTCGAAGG - Intronic
1137621819 16:49881287-49881309 AAGGAGCTCCAGGAGGGAGATGG - Intergenic
1137955589 16:52825685-52825707 AATGAGTTGCAGAGGGAGGCAGG - Intergenic
1138222946 16:55268580-55268602 AGGGTGATCCTGAAGGAGGAAGG - Intergenic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1139138072 16:64229091-64229113 TAGGAATTCCAAAAGGTGGAGGG - Intergenic
1139321657 16:66119218-66119240 AAGGAGGTATAGGAGGAGGAAGG - Intergenic
1139526276 16:67518677-67518699 ACTGAGTTCCAGAGGGAGCAAGG - Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139696607 16:68679729-68679751 AAAGAGTTCCAGAAGTAGACAGG + Intronic
1139878379 16:70164424-70164446 AGGGACTTACAGAAGGAGCAGGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140914711 16:79483189-79483211 AAGGAGGGACAGAAGGAGGGAGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141231374 16:82170485-82170507 AGGGAGTCCCCGAGGGAGGATGG - Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141688923 16:85585652-85585674 GAAGAGTTCCAGAACCAGGATGG - Intergenic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1142537682 17:630955-630977 AAGCAGTTCCCCAAGCAGGATGG + Intronic
1142611691 17:1111930-1111952 AAGCTGTTTCAGAAGGAGGAAGG - Intronic
1142688042 17:1589055-1589077 AACGGGTCACAGAAGGAGGAGGG + Intronic
1143164288 17:4890130-4890152 AGCGAGTTGGAGAAGGAGGAAGG - Intronic
1143460645 17:7101386-7101408 AATGAATTACAGAAGGAGGTGGG + Exonic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144396951 17:14853664-14853686 AGAAAGTTCTAGAAGGAGGAAGG + Intergenic
1144644070 17:16957391-16957413 TAGAAGTTACAGAAGGAGAAGGG + Intronic
1146289741 17:31598710-31598732 AAGGAGCTCCAGAGGGTGGAGGG + Intergenic
1146831104 17:36070297-36070319 AAAGAGATCCAGAAGGAAGCTGG - Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147262955 17:39219383-39219405 AGAGAGTTCCTGGAGGAGGAAGG - Intronic
1147362503 17:39940257-39940279 AAGCAGTTTCAGAAGCATGATGG - Intergenic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1150004814 17:61463081-61463103 AGGTGGCTCCAGAAGGAGGAAGG - Intronic
1150131319 17:62670729-62670751 AAGGAGTCCCAGCTGGGGGATGG + Intronic
1150389547 17:64782245-64782267 AGGGAGTTCCAGAACGAGTGTGG - Intergenic
1150789898 17:68195657-68195679 AGGGAGTTCCAGAACGAGTGTGG + Intergenic
1151019537 17:70599061-70599083 AAGGAGTTTAAAAAGGGGGATGG + Intergenic
1151319448 17:73343687-73343709 AGGGAGGGCCAGAAGGAGGCAGG + Intronic
1151466425 17:74288734-74288756 AAGGAGTTGCAGAAAGTGGGTGG + Intronic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151588852 17:75029923-75029945 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1152009763 17:77705172-77705194 AAAGACTACCAGGAGGAGGAAGG - Intergenic
1152646881 17:81473297-81473319 GAGGAGTTCGAGGAAGAGGAGGG + Intergenic
1153351362 18:4084024-4084046 AAGTAGCTCCAGAAGATGGATGG + Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1153878882 18:9403530-9403552 AAGGAGTTGCAGAAGGATCAAGG + Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154385796 18:13890788-13890810 AAGAAATTCCAGAAGGAGACCGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155280625 18:24235970-24235992 AGAGACTTCCAGATGGAGGATGG + Intronic
1155370177 18:25090909-25090931 AAAGAGTTCCAAAAGAAGGATGG + Intronic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156560813 18:38123368-38123390 AGGAAGTTGCAGTAGGAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1157966244 18:52211493-52211515 TAGGAGGTAAAGAAGGAGGAGGG + Intergenic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159464627 18:68765243-68765265 AAAGAGCTAAAGAAGGAGGAAGG + Intronic
1159863393 18:73675535-73675557 AAGGAGTTTCAGGAAGAGGAGGG - Intergenic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1161504947 19:4639052-4639074 AACTAGCCCCAGAAGGAGGAAGG + Intergenic
1161982111 19:7635390-7635412 AAGCTGTTACAAAAGGAGGAAGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1163523403 19:17805699-17805721 AGGGAGGTCCTGAAGGATGATGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1163962592 19:20711216-20711238 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1164322948 19:24167048-24167070 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1164934238 19:32198700-32198722 AAGGGGTTCAAGAGAGAGGACGG - Intergenic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
1167906758 19:52666981-52667003 AAGTAGTTACAGAATCAGGAAGG + Intronic
1168247322 19:55118930-55118952 AAGGAGTTCCAGCAGGTGGGGGG + Intergenic
1168327531 19:55545845-55545867 AAGGTGTTCCTGTAGAAGGAAGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
927863185 2:26573233-26573255 AGTGAGCTCCAGAAGGAGGGAGG + Intronic
927899700 2:26810555-26810577 TAGGATTTCCAGAAGAAGGTGGG + Intergenic
928063733 2:28141599-28141621 GAAGAATTCCAGAAGGAGCAAGG + Intronic
928805058 2:35140533-35140555 AAGAAGCTGCAGTAGGAGGAGGG + Intergenic
929435172 2:41923275-41923297 AAGGGGTGCCCAAAGGAGGAGGG - Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
929968231 2:46551398-46551420 AATGAGTTCCAGCAGGCAGAGGG + Intronic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931529479 2:63198097-63198119 AATAAATTCCAGAAGGATGAGGG - Intronic
931819277 2:65935241-65935263 AAGGAGAGCCAGAAGGACAAAGG + Intergenic
932036857 2:68253926-68253948 AAGTAGCTCCTGAAGGGGGAAGG - Intronic
932882705 2:75518635-75518657 AAAGAGTTCCAGAAGTGGTAAGG - Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933183728 2:79255656-79255678 AGGGAGTTCCAGAAGGAAGCTGG + Intronic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933690838 2:85178474-85178496 AAGGAGCTGGAGAAGGAGCAGGG + Intronic
934583599 2:95468131-95468153 ATGGTGTGCCAGAAGGGGGATGG + Intergenic
934595853 2:95608583-95608605 ATGGTGTGCCAGAAGGGGGATGG - Intergenic
934736860 2:96694010-96694032 AAGGAGTTGGGGAAGGAAGAGGG + Intergenic
934786921 2:97016905-97016927 ATGGTGTGCCAGAAGGGGGATGG + Intronic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935335815 2:102015219-102015241 AAGGAGCTCCAGAACCTGGAAGG + Intronic
935602012 2:104932285-104932307 AGGAAGTTCCAGGAGGAGAAGGG + Intergenic
936644619 2:114354724-114354746 AGGGAGCTACAGAAAGAGGAGGG + Intergenic
936927727 2:117754878-117754900 AAGAAGGTTTAGAAGGAGGAAGG - Intergenic
937040622 2:118817863-118817885 AAGTAGTTCCAGAATGAAAACGG + Intergenic
937765099 2:125651940-125651962 AAGGAGTGCCAGGAGCAGAAAGG - Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938395484 2:130944368-130944390 TCAGAGTTCCAGAAGGAGAAGGG - Intronic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
940037302 2:149324266-149324288 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
940613710 2:156024118-156024140 AAGGGCTTCCAGAAGGAAGCTGG + Intergenic
942034411 2:171996857-171996879 ATTAAGTTCAAGAAGGAGGAAGG + Intronic
942879774 2:180845207-180845229 TAGTAGCTCCAGAAGGAGAATGG + Intergenic
944138623 2:196429824-196429846 AAAGAGCTCTAGAAGGATGAGGG + Intronic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947476907 2:230458378-230458400 GAGTAGTTTGAGAAGGAGGAAGG + Intronic
947675785 2:231978648-231978670 AATGGGTTCCAGAGTGAGGATGG - Intronic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
948583839 2:239005977-239005999 AAGGGCTTCTAGAAGGAGGCGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168769641 20:407425-407447 AAGGAGGCCCAGGAGGAGGCTGG + Intergenic
1168891264 20:1296563-1296585 AAATAGTTCCAGGAGGAGGCAGG - Intronic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169949132 20:11023464-11023486 TAGTAGTTCCAGAAGGAGCCTGG - Intergenic
1170599810 20:17832700-17832722 GAGGTGTTCCAGAAGAAGGAAGG + Intergenic
1171492673 20:25532298-25532320 TAGGATTTCCAGAAGAGGGAAGG + Intronic
1172239241 20:33401319-33401341 ACGGTGTTCAAGAGGGAGGATGG - Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1174265130 20:49325770-49325792 AGGGAGGGCAAGAAGGAGGAGGG - Intergenic
1177772987 21:25537845-25537867 TGGGAGTTCCAGAAGGAGAGAGG - Intergenic
1178096057 21:29217049-29217071 AAGGAGTGCCAGGAAGTGGAAGG + Intronic
1178323937 21:31628187-31628209 AAGGACTTTCAGAAAGAAGAGGG - Intergenic
1179185691 21:39083701-39083723 AAGAAGTTCCAGAAACTGGAGGG - Intergenic
1180516705 22:16151160-16151182 AAGGACTTGCAGAACCAGGAAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1181812866 22:25414798-25414820 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1182398672 22:30057023-30057045 GGGAAGTTCCAGAAGGAGAAGGG + Intergenic
1182491613 22:30676003-30676025 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1182871436 22:33651038-33651060 AAGGAGTACCAGGAAGTGGAGGG + Intronic
1183414243 22:37673497-37673519 CAGCAGTTTCAGAAGGGGGACGG + Intergenic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1184021105 22:41822058-41822080 AAGGAGTTAGAGAAGGTAGAAGG + Intronic
1184257526 22:43295679-43295701 AGGCAGTTCCAGGAGGAGGGTGG - Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1185202289 22:49514946-49514968 AAGGAGTACCAGCAGCAGGCGGG + Intronic
949134576 3:548282-548304 AAGGAATTAAAGAAAGAGGAAGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949610140 3:5695896-5695918 AAGGACTTACAGAACCAGGAAGG - Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950381711 3:12621046-12621068 AACAAGTTTCTGAAGGAGGAAGG - Intronic
951813358 3:26726364-26726386 AAAAAGTTTCAGAAGTAGGATGG + Intergenic
952470922 3:33650762-33650784 AAGGAGTACAAGAAGGGAGAAGG + Intronic
953469651 3:43155813-43155835 AAGGATTTCCAGAAGAAGAAGGG - Intergenic
954325692 3:49862093-49862115 AAGAAGTTCCAGAAGCGGGACGG - Exonic
954408216 3:50357205-50357227 AAGGAGTTCCAGCTGGGGAAGGG - Intronic
955235776 3:57137662-57137684 AAGGTATTTAAGAAGGAGGAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959961711 3:112305215-112305237 AAGGAGCTCCTAAAGGAGCAAGG + Intergenic
960223401 3:115143860-115143882 CAGAAGTTTGAGAAGGAGGAAGG - Intronic
960338465 3:116446182-116446204 AAGGGGTTCCAAGAGGGGGAGGG - Intronic
960400998 3:117198708-117198730 AAGGAGTTGAAGAAGGAAGAAGG - Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
964097972 3:152955458-152955480 AAAGATTTCCAGCAGAAGGAAGG - Intergenic
965783518 3:172313005-172313027 AAGGAGATCAAGTAGGAGAAAGG - Intronic
966537442 3:181050621-181050643 AGGGAGTTCCAGATGCAAGAGGG + Intergenic
966588742 3:181655881-181655903 AAGGAGTTGAAGGAGGAAGAAGG - Intergenic
966668695 3:182502178-182502200 AGGGACTTGGAGAAGGAGGAAGG + Intergenic
966746663 3:183283468-183283490 AGGGCATTCCAGAATGAGGAAGG - Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967958017 3:194893136-194893158 TAGGAGTTCCAGAAAGAAAATGG + Intergenic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970470737 4:16376989-16377011 AATGAGTTCCAAAGGGAGAAAGG + Intergenic
970565260 4:17325912-17325934 CAAAAGTTCCAGGAGGAGGAAGG + Intergenic
971020961 4:22534888-22534910 AAGTAATTCCAAAAGGAAGATGG - Intergenic
971500264 4:27311453-27311475 AGGGAGATCTAGAAGGAGGGAGG + Intergenic
975265066 4:72353862-72353884 ATGGAATTCTAGAAGTAGGAGGG - Intronic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976647731 4:87402749-87402771 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977322826 4:95540535-95540557 GAGGAGATCCAGAAGGAAAAAGG + Intronic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978223053 4:106300347-106300369 AAGGAGTTGAATAAGGAGTAGGG + Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982419592 4:155178861-155178883 TGGGAGTTCCAAAAGGAGGAAGG - Intergenic
984938383 4:184909721-184909743 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985828034 5:2207187-2207209 AAGGTGTCCCAGAAGGGAGATGG - Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986295659 5:6435948-6435970 AATGCTTTCCAAAAGGAGGATGG + Intergenic
986641504 5:9876133-9876155 AAACAGCTCCAGAAGGATGAGGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987530409 5:19111669-19111691 TAGGAGCTCCAGAAGGATAAAGG - Intergenic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
987956494 5:24748216-24748238 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988004045 5:25384836-25384858 AAGGAGCTCTAGAATCAGGAAGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988456867 5:31394514-31394536 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990644468 5:57828396-57828418 AAGGAGTTAACAAAGGAGGATGG + Intergenic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
991894952 5:71385513-71385535 GAGGAATTCCAGAACGAGGTGGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995499932 5:112793685-112793707 AAGGAGTTCCAAAAAGAAAATGG + Intronic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
996702647 5:126465593-126465615 AAGGCGTTACAGGAGGAGCAGGG + Intronic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
997136134 5:131328491-131328513 ACAGAGTTCCAGAAAGAGGGAGG - Intronic
997884277 5:137616279-137616301 AAGCAGCTTCAGCAGGAGGAGGG + Intergenic
998536711 5:142939509-142939531 CAGGAGTTCTAGAAGGACTAGGG - Intronic
998911923 5:146969267-146969289 AGTGGGTTCCAGATGGAGGAAGG + Intronic
999001511 5:147928823-147928845 AATTAGTACAAGAAGGAGGAAGG - Intergenic
999200066 5:149809954-149809976 AAGGCGTTCCAGGCTGAGGAAGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1001459660 5:171899916-171899938 AAGGACTTTCAGAAAGAAGAGGG - Exonic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002668702 5:180847096-180847118 TAGGAGTCCCAGAAGGAGATGGG + Intergenic
1003097404 6:3153879-3153901 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1003106944 6:3224767-3224789 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1004001487 6:11600841-11600863 AGGGAGGTCTGGAAGGAGGACGG - Intergenic
1004070213 6:12290676-12290698 AAGGAGCTCCAGAAACAGGTAGG + Exonic
1004343571 6:14828390-14828412 AAGGAGCTGCAGAAAAAGGAGGG + Intergenic
1004861960 6:19813520-19813542 TAGGAGTTCTAGAAGAGGGATGG + Intergenic
1005458823 6:26047995-26048017 AAGAAATACCAGAAGGAGAAAGG + Intergenic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007073451 6:39052450-39052472 AAGGCCTCTCAGAAGGAGGAAGG - Intronic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007751985 6:44076489-44076511 AATGATTTCCCGAAGCAGGAAGG - Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008334302 6:50281820-50281842 AAGGAAGTCCACAAGGAAGAGGG + Intergenic
1008728388 6:54450095-54450117 AGGGAATTCCAAAAGGAGAAGGG + Intergenic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010686264 6:78858065-78858087 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1012909849 6:105106284-105106306 AAGGACTTCCATAAGGACCAAGG + Intronic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013598656 6:111684128-111684150 AAGAAGTTTGAGAAGGAGGGAGG + Intronic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014519609 6:122425175-122425197 AAGGAGTTAGAGAAGCAGAATGG - Intronic
1014813623 6:125911588-125911610 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015568839 6:134601370-134601392 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1016353802 6:143195725-143195747 GAGCACTTCCAGAAGGAGGCAGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017506437 6:155072805-155072827 GAGGAGTTCAGGAAGGAGGCTGG + Intronic
1018259007 6:161950870-161950892 AGGGAGTTTCAGGAGAAGGAAGG + Intronic
1018445197 6:163851804-163851826 TGGGAGTTCCAGAAGGAGACAGG - Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018691194 6:166345460-166345482 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1018790296 6:167143180-167143202 AAGGAGGCCCAGAAGGCTGAAGG - Intergenic
1019360534 7:602264-602286 AAGGAGTTACAGACGGCGGCGGG + Intronic
1019494686 7:1332287-1332309 AAGGAGCTCTACAAGGAGGATGG + Intergenic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1020508297 7:9020414-9020436 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022386728 7:29906570-29906592 TGGGAGTTCTAGAAGGAGAAAGG + Intronic
1022454352 7:30545553-30545575 TAGGGGTTGCAGAAGGATGAAGG - Intronic
1022664244 7:32395361-32395383 AAAGATTTCCAGAAAGATGAGGG + Intergenic
1023054424 7:36280051-36280073 AAGGAGTTCGAGCAGCGGGAAGG + Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023843041 7:44107408-44107430 CAGGAGTTCCAGAAGCAGGTGGG - Intronic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026517818 7:71087876-71087898 AAGGAGTGGCAGGAGGAGGCGGG + Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027943622 7:84717601-84717623 AAAGAGTTAGAGAAGGAGAAGGG + Intergenic
1028922886 7:96326405-96326427 GAGGAATTCTAGAATGAGGAGGG - Intergenic
1028987482 7:97019502-97019524 CAGGAGTGCAAGAAGAAGGAAGG + Intergenic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1030529577 7:110696152-110696174 AAGGGGTTCCATAAGCAGTAAGG + Intronic
1030556713 7:111034155-111034177 AAGTAGTTACAAAATGAGGAGGG + Intronic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032121066 7:129157141-129157163 AAAGAGTTCCAGAATGAGATTGG + Intronic
1032385178 7:131517729-131517751 AAAGAGTTACGCAAGGAGGAAGG - Intronic
1032722025 7:134557939-134557961 AACGGGTTACAGTAGGAGGAGGG - Intronic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1032978342 7:137251685-137251707 AAGGAGGTGGGGAAGGAGGAAGG - Intronic
1033062127 7:138119252-138119274 AAGGAGTGACGGAGGGAGGAAGG + Intergenic
1033086317 7:138345267-138345289 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1033276312 7:139974176-139974198 AGGGAGGTCCAGAGGGAGGGTGG + Intronic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1034076019 7:148231864-148231886 ATGCAGTTCCAGAAAAAGGAAGG + Intronic
1034461757 7:151201424-151201446 AAAGAAGTCAAGAAGGAGGATGG - Intronic
1034892698 7:154854917-154854939 AAGGGGTTCCTGAATGTGGAAGG - Intronic
1035291680 7:157843462-157843484 GAGGAGCTCCAGGTGGAGGAAGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037757724 8:21722203-21722225 AGGGAGTCCAAGTAGGAGGAAGG - Intronic
1037829345 8:22178784-22178806 AAGGAGTTTGAGGAGGAGGGAGG - Intronic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1041490767 8:58430235-58430257 AAGCAGTTACAGAAGGCTGAGGG + Intronic
1042151833 8:65795416-65795438 AAGGAGCTCCAGAAGTCTGATGG + Intronic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042302160 8:67296166-67296188 AAGTACTTCCACAAGGAAGATGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043214168 8:77564571-77564593 GAGGCCTTCCAGAAGGTGGAAGG + Intergenic
1043323747 8:79024311-79024333 AAGGTGGTCCTGAAGGAGAAAGG + Intergenic
1044566250 8:93663642-93663664 AATGAATTCCAAAGGGAGGAGGG - Intergenic
1044936953 8:97302617-97302639 GGGGAGTTCCAGATGGAGGTGGG - Intergenic
1045009364 8:97944109-97944131 AGGGAGGTCCAGGCGGAGGAGGG + Intronic
1046072969 8:109281458-109281480 AAGGAGTGAAAGAGGGAGGAAGG - Intronic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047756972 8:127926440-127926462 AAGCAGCTCCAGTTGGAGGAAGG - Intergenic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049309512 8:141925889-141925911 TAGGACTTCCAGGAGGAGGGAGG + Intergenic
1050267574 9:3906940-3906962 GAGGAGTTACATTAGGAGGAGGG - Intronic
1052333877 9:27300022-27300044 AAGTTGTTCCAGGAGGAAGATGG + Intergenic
1052528786 9:29655743-29655765 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1052736231 9:32345252-32345274 ATGGGGTTTGAGAAGGAGGAGGG - Intergenic
1052937697 9:34106751-34106773 AGAGAGTTCCAGATGGAAGATGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053278891 9:36804005-36804027 AAGGAGTTCCAGGAGCATCAGGG - Intergenic
1053529174 9:38861427-38861449 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1053722889 9:40965714-40965736 AAGGAGTTCAAAAAGTAAGAAGG - Intergenic
1054201399 9:62085856-62085878 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054636960 9:67502504-67502526 TGAGAGTTCCAGAAGGAGAAGGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055529681 9:77171499-77171521 AAGTAGGTCCAGGAGAAGGATGG - Intergenic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056728547 9:89143542-89143564 CAGGAGTTTCAGAAGGTGAAGGG + Intronic
1058627791 9:106953325-106953347 AAGGAATTCCAGAGAGAGGGAGG - Intronic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059617638 9:115967995-115968017 AAGGAGTTCAAGAAGTAAGCTGG - Intergenic
1060277598 9:122193741-122193763 AACCAGGTCCTGAAGGAGGAAGG + Intronic
1060451990 9:123751288-123751310 AAAGTGCTCCAGAAGGAAGAAGG + Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061865684 9:133490830-133490852 AAGGAGGTGCTGGAGGAGGAGGG + Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185886773 X:3790169-3790191 AAGCAGTTCCAAGAGGAGGAAGG + Intergenic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1187224167 X:17359931-17359953 TATGACTTCCAGGAGGAGGATGG + Intergenic
1187480210 X:19648372-19648394 AAGGAGGGCAAGAGGGAGGAGGG + Intronic
1187972998 X:24677136-24677158 AGAGTGTTCTAGAAGGAGGATGG - Intergenic
1188567712 X:31545389-31545411 AAGGAATCCCAGAAGGCAGAAGG - Intronic
1189307440 X:39997495-39997517 AAGGAATTGCAAAAGGAAGAGGG - Intergenic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1190517343 X:51237289-51237311 TTAGAGTTCCAGAAGGAGAAGGG + Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192564541 X:72152775-72152797 TAGGATTTCCAGAATTAGGAAGG + Intergenic
1193741087 X:85217826-85217848 AAGGTGTTTCAGAAGGAGTTTGG - Intergenic
1194190687 X:90833675-90833697 ATGGAGTTCAAGAAACAGGAAGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1194946227 X:100071275-100071297 AAGGATTTTCAGACGGGGGAAGG - Intergenic
1195656873 X:107340251-107340273 AAAGACTTCCAGAAGGAGGTGGG + Intergenic
1195676659 X:107511982-107512004 AGAGAATTCCAGAAGGTGGAGGG - Intergenic
1195948814 X:110245265-110245287 AGGGGGTTACAGAAGGAGAAGGG - Intronic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197949028 X:131874219-131874241 GAGTAGTTCCAGAAGGTGTAAGG - Intergenic
1198084957 X:133273671-133273693 AAGGAGTTCCAGAAAAGAGAGGG - Intergenic
1198344542 X:135746803-135746825 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1199271155 X:145883785-145883807 CAGGAGTTCTAGAAGTAGGAAGG + Intergenic
1200537344 Y:4416096-4416118 ATGGAGTTCAAGAAACAGGAAGG - Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic