ID: 1036747795

View in Genome Browser
Species Human (GRCh38)
Location 8:11422449-11422471
Sequence CAGGAAAGGAATGCGTCTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036747788_1036747795 12 Left 1036747788 8:11422414-11422436 CCGAGACCTCAAGGGCTTATCTG 0: 1
1: 0
2: 0
3: 3
4: 175
Right 1036747795 8:11422449-11422471 CAGGAAAGGAATGCGTCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 128
1036747787_1036747795 13 Left 1036747787 8:11422413-11422435 CCCGAGACCTCAAGGGCTTATCT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1036747795 8:11422449-11422471 CAGGAAAGGAATGCGTCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 128
1036747790_1036747795 6 Left 1036747790 8:11422420-11422442 CCTCAAGGGCTTATCTGGAAAGA 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1036747795 8:11422449-11422471 CAGGAAAGGAATGCGTCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036747795 Original CRISPR CAGGAAAGGAATGCGTCTTC AGG Exonic
900931828 1:5742749-5742771 CAAGACAGGCATGTGTCTTCAGG + Intergenic
905658128 1:39699403-39699425 CAGGAAAGGAAGTCTTTTTCAGG + Intronic
912696837 1:111848428-111848450 CAGGAAAGGAGTTAGTCATCAGG - Intronic
916806027 1:168262091-168262113 CAGTAAAAGAATGCGGGTTCTGG - Intergenic
920086392 1:203420948-203420970 CAGGAAGGGAAGGCCTCCTCGGG - Intergenic
920699126 1:208204444-208204466 CAGGAAAGGAGTTTGTTTTCTGG - Intronic
921710874 1:218371776-218371798 CAGGAAAGCCATGCTCCTTCTGG - Intronic
922904714 1:229165179-229165201 GAGGAACGGAATGCTTCTTGGGG - Intergenic
924561594 1:245160790-245160812 AAAGAAAGGAATGCGTCATAGGG + Intronic
1065948326 10:30627090-30627112 CAGGGAAGGAATGTGACTGCAGG + Intronic
1069143221 10:64854946-64854968 CAGGAAAAGAAACCGTTTTCGGG - Intergenic
1069541189 10:69295161-69295183 CAGGGAAGCATTGCATCTTCAGG + Intronic
1070247622 10:74746998-74747020 CCGGAAAAGGAGGCGTCTTCGGG + Intergenic
1079976300 11:27095611-27095633 CTGGAAAGAAAGGCGTTTTCTGG - Intronic
1080713028 11:34769582-34769604 CTGGGAAGGAAGGCGTCCTCTGG + Intergenic
1080909088 11:36576787-36576809 CAGGAAAGAAATTGGTCTTGTGG + Exonic
1083596398 11:63919947-63919969 CAGGCAAGGGATGCAGCTTCTGG - Intergenic
1085007851 11:73111126-73111148 GAGGAAAGGAATGTGTATTCTGG + Intronic
1087190399 11:95248671-95248693 CAGGATAGGAATTAGTGTTCAGG + Intergenic
1090626452 11:128613112-128613134 GAGGAAAGGAATGGGGCATCAGG + Intergenic
1092648898 12:10611774-10611796 AAGAAAAGAAACGCGTCTTCGGG + Intronic
1094367974 12:29704400-29704422 ATGGAAAGGAATGCATCTTGGGG + Intronic
1098877413 12:75880823-75880845 CAGGACAGGATTGCCTTTTCTGG + Intergenic
1099534256 12:83826063-83826085 CAGGAAAGGAATCTGCCTCCTGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105933090 13:25070662-25070684 AGAGAAAGGAATGTGTCTTCCGG + Intergenic
1106001189 13:25724884-25724906 CAGGAAACCATTGCCTCTTCCGG + Intronic
1109315769 13:60747575-60747597 CATGAAAGGAATGCTTCCACCGG - Intergenic
1110501364 13:76231777-76231799 GAGGGAAGGATTGTGTCTTCTGG + Intergenic
1112495322 13:99899361-99899383 CAGGAAAGGAAGGAGAATTCAGG - Intergenic
1113124766 13:106964963-106964985 CAGGAAAGCACTGGATCTTCAGG - Intergenic
1113126132 13:106981647-106981669 CAGGAACAGAATGCGTTTTAAGG - Intergenic
1119559610 14:75579485-75579507 CCGGAAAGAGATGCGGCTTCAGG - Exonic
1119708940 14:76807351-76807373 AAGGAAAGGATGGGGTCTTCAGG + Intronic
1120625632 14:86822362-86822384 CAGAAAAGGAAGGCTTCATCAGG + Intergenic
1122275360 14:100588037-100588059 CAGGAAGGGAAGGTGGCTTCAGG + Intergenic
1124956552 15:34364128-34364150 GAGGAAAGGGAAGCCTCTTCAGG + Intronic
1125691144 15:41597222-41597244 CAGTAAAGGAACTCCTCTTCTGG - Intergenic
1133646515 16:7769743-7769765 GAGGAAAGGAATGCCACATCGGG - Intergenic
1140703635 16:77605802-77605824 CAGGAAATGAATGTATCTTTGGG - Intergenic
1141398714 16:83727718-83727740 CAGGAAAGGCCTGTGTGTTCAGG + Intronic
1144348278 17:14369486-14369508 GAGGAAAGGAATGGGGGTTCAGG + Intergenic
1147556732 17:41484443-41484465 CAGGAATGGAACGAGTCTCCGGG - Intergenic
1150532467 17:65998566-65998588 CAGGAAAAGATTACTTCTTCTGG + Intronic
1151081768 17:71337295-71337317 CAGAAAATGAATCTGTCTTCTGG - Intergenic
1151726200 17:75886114-75886136 CAGGCAAGGAAAGCGTGTGCAGG - Intronic
1152247256 17:79191523-79191545 CAGGACAGTAATGCCTCTCCGGG - Intronic
1153092368 18:1362669-1362691 CAGGAAACTGATGCGTTTTCAGG - Intergenic
1153425795 18:4961491-4961513 CTGGAAAGGACTGTGTCTTGTGG + Intergenic
1154291716 18:13114151-13114173 GTGGAAAGGCATGCGTTTTCAGG - Exonic
1155826094 18:30445119-30445141 CAGGAATAGAGTGAGTCTTCAGG - Intergenic
1155943358 18:31821857-31821879 CAGGAAAGGAATGTGCTTACTGG - Intergenic
1156500638 18:37555134-37555156 CAGGAATGGGATGTGGCTTCAGG + Intronic
1156860146 18:41826730-41826752 CAGGAAAGCAGTGCCTCTCCAGG + Intergenic
1160413248 18:78688844-78688866 CAGGAAAAGAATGCCTCCCCAGG + Intergenic
1167276069 19:48540407-48540429 GAGGAAAGGAAAGAGTGTTCTGG - Intergenic
925736159 2:6965640-6965662 CGGGACAGGATTGCATCTTCAGG + Intronic
927062677 2:19439235-19439257 GAAGCAAGGAATGAGTCTTCAGG - Intergenic
927631623 2:24779328-24779350 CAGGGCTGGAATGCTTCTTCAGG - Intergenic
928254367 2:29709267-29709289 CAGGAAAGAAATGTGTCTGAGGG - Intronic
928456931 2:31430814-31430836 CAGGAAAGGGATGGATCTCCAGG - Intergenic
929303748 2:40335758-40335780 CAGGAAATGAATGTGTTTTGAGG + Intronic
931144211 2:59499279-59499301 AAAGAAAGGAATGCATGTTCAGG + Intergenic
932880079 2:75493178-75493200 CTGGAAAGGAGAGCGTCTGCAGG - Exonic
934545199 2:95208226-95208248 CAGAAAAGTGATGCGTCTTATGG - Intronic
937399420 2:121568989-121569011 CAGGAAAGCCATGTGCCTTCCGG + Intronic
942688016 2:178554526-178554548 AAGGAAATGAATACATCTTCCGG - Exonic
946717302 2:222566071-222566093 CAGGAAAGGCATGAATCTCCAGG - Intergenic
947596810 2:231418156-231418178 CAGGATAGCAAGGCGGCTTCTGG - Intergenic
948068752 2:235102782-235102804 CAGGAACGGGATGCTTCATCTGG + Intergenic
948720752 2:239898576-239898598 CAGGCAAGGAACGCCTCTCCAGG + Intronic
1169619752 20:7491995-7492017 CAGGAAAGGCAGGTGACTTCTGG + Intergenic
1170342656 20:15346581-15346603 CAGGGAAGGAATGTGTGTGCCGG + Intronic
1170568997 20:17622415-17622437 CAGGGAAGCAGTGCGTCTGCTGG + Intronic
1174782672 20:53404428-53404450 CTGAAAAGGAATGGGTATTCAGG - Intronic
1178668114 21:34566536-34566558 CAGGTAAGGCCTGGGTCTTCAGG - Intronic
1179417465 21:41209753-41209775 CAGGAAAGGATAGTGACTTCAGG - Intronic
1181622353 22:24099729-24099751 CAGGAGAGGAATGCCTTTCCTGG + Intronic
949412076 3:3776600-3776622 CAGGCAAGGAATGAATCTCCAGG + Intronic
949859127 3:8489635-8489657 CAGGAAAAGAATGGGCCTTGAGG - Intergenic
950078899 3:10207281-10207303 CAGGAAAGGAATGACTCATCTGG - Intronic
951340234 3:21477092-21477114 CAGGAAAGGAAGGGGTCCACTGG - Intronic
953121592 3:40048268-40048290 AAGGAAAGGAATGCATCTCATGG - Intronic
953669668 3:44951949-44951971 CAGGGAAGGAAGGAGTCTTGGGG - Intronic
955418887 3:58717713-58717735 CAGGAAAACAATGCTTTTTCTGG + Intronic
965068114 3:163878679-163878701 CAGGAAAGGAATGCATTCCCAGG - Intergenic
968023576 3:195418209-195418231 TAGGAAAGGAAAGCTTCTTAAGG - Intronic
968298253 3:197593743-197593765 CAGATAAGGAATGAGTCTCCAGG - Intergenic
970411444 4:15811999-15812021 CAGGAGAGGAATTTTTCTTCTGG + Intronic
971081963 4:23223213-23223235 CAGGAAAGGTCTGCGTATCCCGG + Intergenic
972874032 4:43336479-43336501 CAGAAGAGAAATACGTCTTCAGG - Intergenic
975503960 4:75117673-75117695 GAGGAAAGGACTGCATCTTGTGG + Intergenic
979075080 4:116260889-116260911 TAGGAAAGGAATGCATTTCCTGG + Intergenic
979808902 4:125011344-125011366 CAGAGAAGGAATGCGTCCTCAGG + Intergenic
979974726 4:127182853-127182875 GAGGAAAAGAATGTGTATTCTGG - Intergenic
981520089 4:145652177-145652199 CAGGAGAGAAATGTGTCTTGAGG - Intronic
982773813 4:159421885-159421907 CAGTAATGGAATGGGACTTCGGG + Intergenic
986169922 5:5307042-5307064 CAGGAAAGGAATGCGAGCCCTGG + Intronic
987041617 5:14068325-14068347 CAGTAAATGACTGGGTCTTCAGG + Intergenic
991634554 5:68691570-68691592 CAGGAAAAGGATGCGACTTTAGG - Intergenic
992251031 5:74876162-74876184 CATCAAAGGAATGGGTTTTCAGG + Intergenic
995257197 5:110060304-110060326 CAGGAAAGAAATGTGTCATCGGG - Intergenic
996615317 5:125434465-125434487 CAGGAAAGTAATGAGCCTTTTGG + Intergenic
1000357914 5:160418816-160418838 CAGGCCAGGCCTGCGTCTTCAGG - Intronic
1001338543 5:170822477-170822499 GAGGAAAGAAAGGCTTCTTCGGG - Intergenic
1001894298 5:175365320-175365342 CAGGAAAGGGATGTGTCTCATGG + Intergenic
1007799543 6:44380647-44380669 CAGGAAAGAAAAGCCTCTTTAGG - Intergenic
1012216685 6:96594376-96594398 CAAGAAAGGAGTGCATCCTCTGG - Intronic
1015006061 6:128283152-128283174 CAGGAAAGGAGTGAGCCTTGGGG - Intronic
1015826731 6:137320728-137320750 CAGGAGAGGAAAGCATCTTCTGG - Intergenic
1016475514 6:144422837-144422859 CAAGAAAGAAATTCATCTTCAGG - Intronic
1018028092 6:159821278-159821300 CAGGAAAGGGGTGCGACCTCTGG - Intergenic
1018944489 6:168337008-168337030 CAGGAAAGGATGGCGGCTACTGG - Intergenic
1024041230 7:45557245-45557267 CAGGAAAGCAATGCAAATTCTGG - Intergenic
1034776270 7:153829666-153829688 GAGGAAAGGAATGCCACTTCTGG + Intergenic
1035393353 7:158520117-158520139 CAAGAAAGGAAAGCATTTTCTGG + Intronic
1036480216 8:9132855-9132877 CAGGAAAGCAGGGGGTCTTCAGG + Intergenic
1036656602 8:10681256-10681278 AAGGAAAGGACTCCTTCTTCTGG - Intronic
1036747795 8:11422449-11422471 CAGGAAAGGAATGCGTCTTCAGG + Exonic
1037922155 8:22815009-22815031 CAGGAAAGGCATGTGACTTGGGG + Intronic
1042209839 8:66369132-66369154 CAGTGAATGAATGAGTCTTCAGG - Intergenic
1042353369 8:67800445-67800467 CAATACAGCAATGCGTCTTCAGG - Intergenic
1043437819 8:80251743-80251765 CAGGGAAGGAAAGAGCCTTCCGG + Intergenic
1044818927 8:96143113-96143135 CAGGGGTGGAATTCGTCTTCTGG - Exonic
1051452180 9:17209372-17209394 GAAGAAAAGAATGCGTATTCTGG + Intronic
1058959576 9:109979988-109980010 CAGGAAAGAAGTGTGTCCTCAGG + Intronic
1059232903 9:112737885-112737907 CATGAAATGAATGTGTCTTGAGG + Intergenic
1059323086 9:113484173-113484195 CTGGAACGGTCTGCGTCTTCTGG - Exonic
1059519366 9:114925424-114925446 CAGACAAGGAATGAGTCTCCAGG + Intronic
1060583915 9:124774173-124774195 CTGGAAAGGAATGTGTCTAAGGG + Intergenic
1186749091 X:12602962-12602984 CTGGAAAGGAATGTGGCATCTGG + Intronic
1187167973 X:16822537-16822559 CAGGAAAGGAATGCTTCCATTGG + Intronic
1190283326 X:48945908-48945930 CAGGAAAGGTCTGCTGCTTCTGG - Intronic
1193296080 X:79831855-79831877 CAGGACAGGCATGCCTGTTCTGG - Intergenic
1201953348 Y:19590607-19590629 CAGGAAAGGAATGCTTCCATTGG + Intergenic