ID: 1036749941

View in Genome Browser
Species Human (GRCh38)
Location 8:11437167-11437189
Sequence CACTGCAGGGCTTTGAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036749928_1036749941 23 Left 1036749928 8:11437121-11437143 CCAGGGGCCTCACAGTTTCCTAT No data
Right 1036749941 8:11437167-11437189 CACTGCAGGGCTTTGAGGTCGGG No data
1036749933_1036749941 5 Left 1036749933 8:11437139-11437161 CCTATAGCATGGTGGGTGAATCC No data
Right 1036749941 8:11437167-11437189 CACTGCAGGGCTTTGAGGTCGGG No data
1036749929_1036749941 16 Left 1036749929 8:11437128-11437150 CCTCACAGTTTCCTATAGCATGG No data
Right 1036749941 8:11437167-11437189 CACTGCAGGGCTTTGAGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036749941 Original CRISPR CACTGCAGGGCTTTGAGGTC GGG Intronic