ID: 1036750112

View in Genome Browser
Species Human (GRCh38)
Location 8:11438323-11438345
Sequence AGCTGATGAGTTGGGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750112_1036750118 1 Left 1036750112 8:11438323-11438345 CCAGCAGCCCCAACTCATCAGCT 0: 1
1: 0
2: 1
3: 25
4: 258
Right 1036750118 8:11438347-11438369 TCACATCAAACAGGAATGTTGGG 0: 1
1: 0
2: 2
3: 19
4: 160
1036750112_1036750119 11 Left 1036750112 8:11438323-11438345 CCAGCAGCCCCAACTCATCAGCT 0: 1
1: 0
2: 1
3: 25
4: 258
Right 1036750119 8:11438357-11438379 CAGGAATGTTGGGAGATTGAAGG 0: 1
1: 0
2: 0
3: 24
4: 238
1036750112_1036750116 -8 Left 1036750112 8:11438323-11438345 CCAGCAGCCCCAACTCATCAGCT 0: 1
1: 0
2: 1
3: 25
4: 258
Right 1036750116 8:11438338-11438360 CATCAGCTCTCACATCAAACAGG 0: 1
1: 0
2: 2
3: 15
4: 110
1036750112_1036750117 0 Left 1036750112 8:11438323-11438345 CCAGCAGCCCCAACTCATCAGCT 0: 1
1: 0
2: 1
3: 25
4: 258
Right 1036750117 8:11438346-11438368 CTCACATCAAACAGGAATGTTGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750112 Original CRISPR AGCTGATGAGTTGGGGCTGC TGG (reversed) Intronic
901323006 1:8350651-8350673 AGCTGATGAGTGGTGGCGGGGGG - Intergenic
901503476 1:9668872-9668894 AGCAGATGAGTAGGGGCTGACGG + Intronic
902957230 1:19933975-19933997 AGCTGAGGACCTGGGGCTGGTGG + Intergenic
903665172 1:25001631-25001653 GGCTGGGGAGTTGGGGCTGGGGG + Intergenic
904631909 1:31848808-31848830 AGCAGATGAGTTCCTGCTGCAGG - Intergenic
905434400 1:37946851-37946873 AGCTGATGCAATGGGCCTGCTGG - Intronic
905907078 1:41626307-41626329 AGGTGCTGACTTGGTGCTGCTGG - Intronic
906544178 1:46609792-46609814 AGCCTAAGAGTTGGGGTTGCTGG - Intronic
908046798 1:60179081-60179103 AGCTGATTAGCTGGGACTACAGG - Intergenic
912960396 1:114190919-114190941 AACTGATGAGGTGGGGGTCCAGG - Intergenic
913975241 1:143450493-143450515 AGATGATGAGTAGGGTCAGCAGG + Intergenic
914069634 1:144276109-144276131 AGATGATGAGTAGGGTCAGCAGG + Intergenic
914109521 1:144690245-144690267 AGATGATGAGTAGGGTCAGCAGG - Intergenic
914352372 1:146851769-146851791 AGCTGAGTAGTTGGGACTGCAGG + Intergenic
915912380 1:159923082-159923104 AGCTGATGGGCTGCGGCTGCTGG + Intronic
916604574 1:166328051-166328073 AGCTGCTAAATTGGGGCTGGAGG - Intergenic
917461387 1:175233477-175233499 AGCTGATGTGTTGAGAGTGCTGG + Intergenic
917594907 1:176519375-176519397 AGGTGAGGAGGTGGGGCTGGTGG + Intronic
919836356 1:201576451-201576473 AGCTGATAAGCTGGGGATGGTGG + Intergenic
923285643 1:232492421-232492443 AGCTCAGGAGTTGAGGCTGTAGG - Intronic
1063438336 10:6052561-6052583 AGCTGATGGGTTGAGGGTACAGG - Intronic
1064763866 10:18651377-18651399 AGCCGATTAGAAGGGGCTGCCGG + Exonic
1065033298 10:21610409-21610431 AGCTGTTGGGGTGGGGATGCTGG + Intronic
1069590210 10:69636813-69636835 AGCTGATCTCATGGGGCTGCAGG - Intergenic
1070691880 10:78533120-78533142 AGCTGATGAGGTTGGTCAGCCGG + Intergenic
1071334194 10:84588364-84588386 ACCTGCTGAGTGGGGGCTGCAGG - Intergenic
1072681480 10:97510393-97510415 AGCTAATGAGTTGGAGGAGCTGG - Intronic
1074362297 10:112833206-112833228 TTCTGATGAGTAGAGGCTGCAGG - Intergenic
1076294653 10:129375245-129375267 AGCTGGTGAGGTGGGGCCGCAGG - Intergenic
1076730763 10:132437735-132437757 AGGGAATGAGTTGGGCCTGCGGG + Intergenic
1076909551 10:133380066-133380088 GGCTGCTGAGTACGGGCTGCTGG + Exonic
1077261259 11:1622128-1622150 AGCAGATGAGATGGAGGTGCAGG + Exonic
1080304650 11:30823184-30823206 AGCTGGTAAGTTTGAGCTGCTGG - Intergenic
1083780208 11:64913763-64913785 AGATGGGGAGTGGGGGCTGCTGG - Intronic
1083901323 11:65644896-65644918 AGCTGGTGGGGTGGGGCTGCAGG + Intronic
1084164226 11:67367474-67367496 AGCTGCGGAGTTGGTGCTCCAGG + Exonic
1084309560 11:68308899-68308921 AGCTGATTAGTTGGGCTTGGTGG - Intergenic
1084356183 11:68640357-68640379 AGTTGTTGGGTTGGGGCTGTAGG + Intergenic
1084433746 11:69126149-69126171 GGCTGATCAGATGGGGCTTCAGG + Intergenic
1084676493 11:70638407-70638429 AGCTGAGGGTCTGGGGCTGCAGG + Intronic
1085129758 11:74028285-74028307 ACCTGATCTGTTGTGGCTGCTGG + Exonic
1087077809 11:94141971-94141993 AGGTGACGACCTGGGGCTGCTGG + Intronic
1088910027 11:114183707-114183729 GGCTGATGATTTGGGACTGGGGG + Intronic
1089367777 11:117931624-117931646 AGTTGATGTGTTGGGGCGGGTGG + Intergenic
1089968495 11:122673235-122673257 AACTGTTGAGCTGGGGATGCAGG + Intronic
1090596534 11:128326941-128326963 AGGTGATGAGTTGGGGAGGGAGG - Intergenic
1091592309 12:1851000-1851022 AGCTGAGTAGCTGGGACTGCAGG + Intronic
1091991591 12:4960305-4960327 AGCTGGGGAGGTGTGGCTGCAGG + Intergenic
1096192673 12:49630664-49630686 GGCTGGGGAGTTGGGGGTGCAGG - Intronic
1099220902 12:79912568-79912590 ACCTGAGTAGTTGGGACTGCAGG - Intronic
1100233477 12:92633758-92633780 AAATGCTGGGTTGGGGCTGCAGG - Intergenic
1100585760 12:95977917-95977939 TGCTGATGAGTTCGGGGTGGCGG - Intronic
1102156030 12:110728783-110728805 AGCTGATAAGATGGGGTGGCAGG - Intronic
1103262744 12:119602592-119602614 AACTGATGAGGCAGGGCTGCTGG - Intronic
1105022003 12:132823006-132823028 ACCTGAAGGGGTGGGGCTGCCGG - Intronic
1106466214 13:30016592-30016614 AGCTGGAGAGTTGGGACAGCTGG - Intergenic
1106591913 13:31105372-31105394 AGCTGATGAGAAAGGGCTCCTGG - Intergenic
1108095393 13:46895410-46895432 AGCAGATGAGATGGGGCTCAGGG - Intronic
1113859474 13:113471896-113471918 TGGTGATGAGCAGGGGCTGCTGG + Intronic
1114567119 14:23640808-23640830 AGCTGCTCAGCAGGGGCTGCAGG - Intronic
1114635645 14:24185297-24185319 AGCTGCTGATATGGGGCTGGGGG + Exonic
1115745212 14:36429499-36429521 AGAGGATGAGATGGGGCTGGAGG + Intergenic
1117335541 14:54754480-54754502 AGCTGATGAGATGGGGTGGGAGG + Intronic
1117987391 14:61400949-61400971 ATCTGAGGAGTTGGGGGTGGGGG + Intronic
1119081346 14:71697145-71697167 AGAGGGTGGGTTGGGGCTGCTGG + Intronic
1119228107 14:72959683-72959705 AGATCATGAGCTTGGGCTGCTGG + Intronic
1120933039 14:89867541-89867563 GGCAGTTGCGTTGGGGCTGCAGG - Intronic
1121131807 14:91454102-91454124 AGCTGAGGAGTTAGAGGTGCTGG + Intergenic
1121818001 14:96943189-96943211 GGCTGCTGAGTTGGGGGTGGGGG - Intergenic
1122384349 14:101333804-101333826 TGGTGCTGACTTGGGGCTGCTGG - Intergenic
1122913722 14:104846191-104846213 AGGTGATGAGATGTCGCTGCTGG + Intergenic
1123862583 15:24484229-24484251 CGCTGAGGAGCTGGGACTGCAGG + Intergenic
1127681365 15:61301864-61301886 GGCTGATGAGTGGGAGCAGCTGG + Intergenic
1127763731 15:62165039-62165061 AGCTGCTGAGTTTGGGCGCCTGG + Intronic
1127831447 15:62754792-62754814 AGCAAATGAGTTGAGGCTGGCGG + Intronic
1128283396 15:66416064-66416086 GAGTGATGAGATGGGGCTGCAGG - Intronic
1128552483 15:68607369-68607391 ACATGATGACTTGGGGCTCCAGG + Intronic
1129193825 15:73952779-73952801 AGATCATGAGGTGGGGCTGCAGG + Intergenic
1130831836 15:87608971-87608993 GGGTGATGAGTTGGGGGTGGGGG - Intergenic
1131259015 15:90878999-90879021 GGCTGGGGAGATGGGGCTGCTGG + Intronic
1133030754 16:3009935-3009957 AGCCCCTGGGTTGGGGCTGCTGG + Intergenic
1133317761 16:4894769-4894791 AGCACATGTGTTGAGGCTGCCGG + Intronic
1133858855 16:9575164-9575186 CGCTGCTGGATTGGGGCTGCTGG + Intergenic
1135076233 16:19396134-19396156 ATCTGATGAACTGGGGGTGCAGG + Intergenic
1135193674 16:20376701-20376723 AGCTGAGGAATGGGGGCTGCAGG - Intronic
1136459270 16:30399619-30399641 AGCTGCAGAGATGGGGCTTCTGG + Exonic
1136565168 16:31065442-31065464 GTCTGAGGAGTGGGGGCTGCAGG + Intronic
1138026459 16:53525945-53525967 GGATGATGGGTTGGGGATGCAGG + Intergenic
1138117942 16:54375129-54375151 AACTGAGGAGTTGAGGGTGCTGG + Intergenic
1139506147 16:67399055-67399077 TTCTGAGGAGTTGGGGCTGTGGG - Intronic
1139981657 16:70863750-70863772 AGCTGAGTAGTTGGGACTGCAGG - Intronic
1140435020 16:74939868-74939890 AGCTGAGTAGCTGGGACTGCAGG - Intronic
1141016851 16:80458894-80458916 AGTTGGTGAGTTGGGACTCCAGG - Intergenic
1141763266 16:86043024-86043046 AGATGCTGAGGTGGGGCTGGTGG + Intergenic
1141854112 16:86669546-86669568 AGGGGATGCGTAGGGGCTGCAGG - Intergenic
1142368475 16:89663993-89664015 CCCTGATTAGTTGGGGCTACAGG - Intronic
1142847350 17:2688588-2688610 TGCTGCTGGGCTGGGGCTGCTGG + Intergenic
1142887905 17:2924623-2924645 AGCGAATGAGATGGGGCTGGTGG + Intronic
1143112014 17:4558239-4558261 GGCTGATGTGTTGGGGCTTGTGG - Exonic
1143282671 17:5766454-5766476 CGCTCCTGAGGTGGGGCTGCAGG - Intergenic
1143591040 17:7885803-7885825 TGCTGATGAGTAGGGGCAGGTGG + Intronic
1143708407 17:8716599-8716621 TCCTGATTAGTTGGGGCTACAGG - Intergenic
1143962400 17:10731491-10731513 AGCATATGAATTGGGGGTGCAGG - Intergenic
1144180168 17:12744353-12744375 GGCTGAGGATTTGGAGCTGCAGG - Exonic
1147326881 17:39673861-39673883 AGCTGATGTGTTGGGGGTTGGGG + Intronic
1147780069 17:42934813-42934835 AGGGGCTGAGTGGGGGCTGCAGG - Intergenic
1147978108 17:44259395-44259417 TGCTGAAGAGATGGGGCTGCGGG + Intronic
1148482373 17:47968444-47968466 AGCTGAGTAGCTGGGACTGCAGG + Intronic
1150272628 17:63876500-63876522 AGGTGATGAGTCTGGGGTGCTGG - Intronic
1150273967 17:63884249-63884271 AGGTGATGAGTCTGGGGTGCTGG - Intergenic
1150278278 17:63913777-63913799 AGGTGATGAGTCTGGGGTGCTGG - Intronic
1151808489 17:76421734-76421756 AACTGATGCCTTGGGACTGCTGG + Intronic
1152376644 17:79921983-79922005 AGCCCAGGAGTTGGGGCTGGGGG + Intergenic
1152747937 17:82049799-82049821 AGCTGAGCAGGTGCGGCTGCCGG - Exonic
1154157249 18:11953426-11953448 AGCTGTTGGGATGGGGCTTCTGG + Intergenic
1155399105 18:25418598-25418620 AGGTGAGGACTTGGGGTTGCGGG + Intergenic
1156226670 18:35116553-35116575 AGTTGTTGACTTGAGGCTGCAGG + Intronic
1157463262 18:47921031-47921053 ACCTGAGTAGTTGGGACTGCAGG - Intronic
1157605429 18:48923200-48923222 AGAGGAGGAGCTGGGGCTGCAGG - Intronic
1158701695 18:59754287-59754309 AGCTAAGCAGCTGGGGCTGCTGG - Intergenic
1160723475 19:607552-607574 AGCTGAGGACTTGGTGCGGCAGG + Intronic
1163039928 19:14594545-14594567 GGCAGGTGAGTTGGGGCTGGGGG + Exonic
1163582951 19:18149227-18149249 AGCTGGGGAGGCGGGGCTGCTGG - Exonic
1164236491 19:23341172-23341194 TCCTGAGGAGTTGGGGCTGCAGG + Intronic
1164393790 19:27846692-27846714 AGGAGCTGAGTTGGGGATGCAGG + Intergenic
1165026493 19:32966371-32966393 TGGAGATGGGTTGGGGCTGCGGG + Exonic
1165776146 19:38405379-38405401 AGCAGCTGAGGAGGGGCTGCAGG - Exonic
1166006851 19:39914035-39914057 AGCTGATGACCTGGCTCTGCGGG - Exonic
1167453366 19:49585150-49585172 AGCTGCTGGGATGGGGCTGTGGG - Intronic
1168435759 19:56315562-56315584 AGCTGATGTGAAGGGGCTGTGGG + Intronic
926737394 2:16083780-16083802 AGCCAGTGAGTTGGGGCTCCCGG - Intergenic
929059973 2:37914030-37914052 ACCTGAAGAGTTGGGGATGGAGG + Intergenic
932717371 2:74111313-74111335 GCCTCATGAGTTTGGGCTGCTGG + Intergenic
932751779 2:74375871-74375893 AGCTGCTGGATTGGGGCTGTGGG - Intronic
933581432 2:84131034-84131056 AGCTCATGAGTTGGGAGTGGGGG - Intergenic
934179941 2:89611466-89611488 AGATGATGAGTAGGGTCAGCAGG + Intergenic
934986989 2:98894644-98894666 GGCTGAGGAGTTGAGGCTGTTGG - Intronic
935072456 2:99706901-99706923 AGATGATATGTTGGGGCTGCTGG - Intronic
936145552 2:109978385-109978407 AGCTGATGAACAGGGGCTGCGGG + Intergenic
936199134 2:110393093-110393115 AGCTGATGAACAGGGGCTGCGGG - Intergenic
936279661 2:111126521-111126543 AGAGGATGAGTTGGGGTTGGGGG + Intronic
937841813 2:126532135-126532157 TCCTGAAGAGCTGGGGCTGCAGG - Intergenic
939951674 2:148482858-148482880 AGCTGGTGAGTTGTGGTGGCAGG - Intronic
943441314 2:187931617-187931639 GGCTGATGAGTTGGGCTTTCAGG + Intergenic
943816484 2:192263706-192263728 AGCTGAATAGCTGGGACTGCAGG - Intergenic
946233320 2:218306261-218306283 AACTGATGGCTAGGGGCTGCAGG + Intronic
947418510 2:229921805-229921827 AGCTGAGGGGTTGGGGGGGCGGG - Intronic
948537041 2:238654076-238654098 AGCTCATGTGTGGGGGTTGCTGG + Intergenic
948642608 2:239385185-239385207 AGCTGAGGTGCTGGGGATGCTGG - Intronic
948951744 2:241256912-241256934 AATGGATGAGTTGGTGCTGCTGG - Intronic
949079963 2:242088771-242088793 AGGTGAAGACTGGGGGCTGCAGG + Intergenic
1171325049 20:24283829-24283851 AGCTGAGGAGTGGGTGGTGCAGG - Intergenic
1171559354 20:26108801-26108823 ACCTGAGTAGCTGGGGCTGCAGG - Intergenic
1172257014 20:33527981-33528003 AGCTGAACAGTTGGGATTGCAGG + Intronic
1172623539 20:36334737-36334759 AGATTGGGAGTTGGGGCTGCTGG + Intronic
1173347675 20:42215820-42215842 AGGTGATGAGTTTGGGTTGCTGG - Intronic
1173752332 20:45487334-45487356 GGCTGAGGAGTCGGGGCTGGAGG - Intergenic
1174190444 20:48736650-48736672 ACCTTGTGAGTGGGGGCTGCTGG + Intronic
1175226017 20:57444507-57444529 AGCTGATGGGGTGGTGCAGCGGG + Intergenic
1175752375 20:61508394-61508416 AGCCAATGGGTTGGGGCTGGGGG - Intronic
1175916904 20:62430257-62430279 ACCTGAGGGGCTGGGGCTGCTGG + Intergenic
1176136098 20:63522611-63522633 GGCTGAGGGGTAGGGGCTGCAGG + Intergenic
1176150492 20:63588369-63588391 AGCTGGTGGGTGGGGGCCGCAGG + Exonic
1176962984 21:15180687-15180709 AGCTGAGTAGCTGGGACTGCAGG + Intergenic
1179404809 21:41116477-41116499 AGCTGATGACTCAGGGATGCTGG - Intergenic
1179954634 21:44731675-44731697 AACTGATGAATGGGGGCAGCTGG - Intergenic
1180000143 21:44991812-44991834 AGCTGCTGAGTTTTGGCTCCCGG - Intergenic
1180180697 21:46117563-46117585 GGCTGCTGGGCTGGGGCTGCTGG - Intronic
1180701558 22:17784140-17784162 AGCTGCTAAGTTGCCGCTGCTGG - Intergenic
1181235708 22:21446692-21446714 GGCTGATGAGGTTGCGCTGCTGG - Exonic
1181646539 22:24234285-24234307 AGCATATGAGCTGGTGCTGCTGG - Intronic
1181968389 22:26672282-26672304 AGCAGATGACCTGGGGCTACTGG + Intergenic
1182093677 22:27612442-27612464 GGCTGAGGAGTGGGGGCTTCTGG - Intergenic
1182300519 22:29334453-29334475 GGCTGTTGAGTTTGGGCTGCAGG - Intronic
1182898190 22:33875822-33875844 AGCCCATCAGGTGGGGCTGCCGG - Intronic
1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG + Intronic
1184330708 22:43825467-43825489 AGAGGATGAGTTGGGTCTGTTGG - Exonic
1184609439 22:45593335-45593357 AGCTGATGTGCTGGGGATCCAGG - Intronic
1185377643 22:50489491-50489513 AGCGGCTCACTTGGGGCTGCAGG - Intronic
950042593 3:9929893-9929915 GGCTGGTGAGTTGGGCCTGGGGG + Exonic
952413361 3:33068864-33068886 GGCTCATGAGCTGGGACTGCTGG - Exonic
953810213 3:46105843-46105865 TGCTGGTCAGTAGGGGCTGCTGG + Intergenic
954104131 3:48399975-48399997 TGCTGGTGAGTTGGTGCTGCTGG - Intronic
954151438 3:48659409-48659431 AGCTGAGGAGTTTGAGGTGCGGG - Exonic
955482262 3:59401813-59401835 AGCTGAAGTGTTGGCCCTGCAGG + Intergenic
957683393 3:83469451-83469473 TCCTGATTAGTTGGGGCTACAGG - Intergenic
961088205 3:124088334-124088356 ATCAGATGAGTTGGGGCAGCTGG + Intronic
962308419 3:134308968-134308990 AGATGATCTGTTGGGGGTGCAGG + Intergenic
962385109 3:134926637-134926659 TGCTGCTGAGATGGGGCTGGAGG + Intronic
963192389 3:142487211-142487233 AGCCTAGGAGTTGTGGCTGCAGG - Intronic
963850655 3:150207416-150207438 AGCTGCTGGGTTGGGGATGAGGG - Intergenic
964690211 3:159441930-159441952 AGCTGAGGAGATAGGACTGCTGG - Intronic
966648449 3:182272314-182272336 GGCTGAAGAATTGGGTCTGCAGG + Intergenic
968568319 4:1326658-1326680 AGAGGCCGAGTTGGGGCTGCTGG - Intronic
968615066 4:1574003-1574025 AGGGGAAGAGTTGGGGATGCAGG - Intergenic
969695158 4:8730026-8730048 AGCTGTTGAGTTTGCTCTGCGGG + Intergenic
969829340 4:9782164-9782186 AGATGATGAGTAGGGTCAGCAGG - Exonic
969925905 4:10585691-10585713 ACCTGAGGAGTTGGGACTACAGG - Intronic
971359205 4:25921464-25921486 AGCTGAGGAGATGGAGATGCTGG + Intronic
971802213 4:31307106-31307128 GGAAGATGAGTTGGAGCTGCTGG + Intergenic
974403192 4:61430284-61430306 AGCTGATGAGATGGCTTTGCAGG + Intronic
974437200 4:61871152-61871174 TGCTGAGTAGTTGGGACTGCAGG - Intronic
978775755 4:112505496-112505518 ACCTGAAGAGTTGGGACTACAGG + Intergenic
980376406 4:131955247-131955269 TCCTGATGAGTTGGGACTACAGG + Intergenic
980682883 4:136187161-136187183 AGCTGATCATTTGGGGCTCATGG - Intergenic
981066761 4:140494019-140494041 AGCAGATGACTAGGGGCTCCTGG + Intronic
984802651 4:183729063-183729085 TCCTGATTAGCTGGGGCTGCAGG + Intergenic
985014859 4:185623451-185623473 AGCTGATGAGGTGGCGGTGGTGG + Exonic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985739564 5:1606995-1607017 AGCAGCTGAGTTGGAGCAGCTGG + Intergenic
986304485 5:6505297-6505319 GGCTGATGAGTCAGGACTGCAGG - Intergenic
986608016 5:9542192-9542214 AGCAGGTGAGATGTGGCTGCTGG - Intronic
987586065 5:19858288-19858310 AGATAATGAGTTGGGGATACAGG + Intronic
988737890 5:34040745-34040767 AGCTCCTGGGTTGGGGATGCAGG - Intronic
991254988 5:64603757-64603779 AGATGATGAGCTGGGGCAGCCGG + Intronic
992713966 5:79490875-79490897 AGCCCAGGAGTTGAGGCTGCAGG + Intronic
994790020 5:104212737-104212759 AGCAGAAGAGTTGGATCTGCAGG + Intergenic
995648299 5:114338777-114338799 GGCTGCTGAGTTCAGGCTGCAGG - Intergenic
996927052 5:128840142-128840164 AGTTGAAGAGTTAGGGCTTCAGG + Intronic
997472479 5:134124587-134124609 AGCTATGGAGTTGGGGCTGCGGG - Intronic
998152264 5:139764315-139764337 AATTAATGAGTGGGGGCTGCAGG + Intergenic
999370450 5:151052118-151052140 GGGTGAGGAGTGGGGGCTGCAGG - Intronic
1001518946 5:172377117-172377139 AGCAGAGGAGTGGGGGCGGCAGG + Intronic
1002067316 5:176658351-176658373 AGCTGATGAGGCGGAGCTGAGGG - Exonic
1003034189 6:2628711-2628733 TGGTAAGGAGTTGGGGCTGCAGG + Intronic
1003735749 6:8876085-8876107 GGCTCATGAGCTGGGGCTGGGGG + Intergenic
1005928367 6:30463390-30463412 TGCTGATGAGCTGGGACTGAGGG + Intergenic
1008222964 6:48876797-48876819 ATCTGATGAACTGGGGGTGCAGG - Intergenic
1008597879 6:53061519-53061541 AGCTGCTGGGATGGGGCGGCGGG - Intronic
1010080672 6:71857154-71857176 AGGTTATGAGGTGGGGCTCCAGG + Intergenic
1013783183 6:113751197-113751219 TCCTGAGGAGCTGGGGCTGCAGG - Intergenic
1016250248 6:142032184-142032206 AGCTGAGTAGTTGGGACTGCAGG - Intergenic
1017812942 6:157997089-157997111 AGTTGGTGTGTGGGGGCTGCAGG - Intronic
1018122315 6:160647286-160647308 AGCTGAGGAGTTTGGGCTGCGGG + Intronic
1018368921 6:163149691-163149713 AGGTGTTGGGTTGGGGCTGCGGG - Intronic
1022796833 7:33738445-33738467 AGCTGATGTGTTAGTGCTGGTGG + Intergenic
1023354534 7:39353743-39353765 AGGTGATGGACTGGGGCTGCAGG + Intronic
1023883858 7:44336701-44336723 AGCTGAAGAGGTGGAGCAGCGGG + Intergenic
1026585965 7:71656437-71656459 AGCTGCAGAGATGAGGCTGCAGG + Intronic
1026872446 7:73861262-73861284 TGCTGGTGAGTGGGGGCTGGGGG + Exonic
1027181036 7:75939515-75939537 AGCTGTTGAGTAGGGCCTGTGGG - Intronic
1027215622 7:76181631-76181653 AGCTGAGGACCTGGGGTTGCAGG + Intergenic
1028983206 7:96989726-96989748 AGGTGCTGGGTTGCGGCTGCCGG - Intergenic
1028986506 7:97013288-97013310 AGCTGGTGTGTTGGGGCGGGGGG - Intergenic
1029181259 7:98703621-98703643 AGCAGATGAGCTGGGGCTGGCGG - Intergenic
1029466491 7:100728562-100728584 AGATGGAGAGCTGGGGCTGCAGG - Intergenic
1029506746 7:100967646-100967668 AGGAGATGGGATGGGGCTGCAGG - Exonic
1029695715 7:102211912-102211934 GGCTGATGAGATGAGGCTGGGGG + Intronic
1029734984 7:102460665-102460687 AGCTGAGGAGATGGGAGTGCAGG - Intronic
1030992807 7:116320876-116320898 AGCTAATTAGCTGGGCCTGCTGG + Intronic
1031521275 7:122769464-122769486 AGGTGAAGAGTTGGGGATGTAGG - Intronic
1034775541 7:153823440-153823462 GGATGAAGAGTTGGGGTTGCAGG + Intergenic
1036750112 8:11438323-11438345 AGCTGATGAGTTGGGGCTGCTGG - Intronic
1037883962 8:22586578-22586600 GGCTGATGTATTGGGGCTGGGGG + Intronic
1040462113 8:47659180-47659202 AGCCCAGGAGTTGAGGCTGCAGG + Intronic
1043561539 8:81499558-81499580 AGCAGATGAGTTGGGGGGGGGGG + Intergenic
1043844454 8:85148679-85148701 TGCTGACCAGCTGGGGCTGCCGG - Intergenic
1044871205 8:96621641-96621663 AACTGATTACTTGTGGCTGCAGG - Intergenic
1047255125 8:123208332-123208354 AGCTGAGGAGTTTGGGGTGTTGG + Exonic
1047464013 8:125094973-125094995 TCCTGAGGAGCTGGGGCTGCAGG + Intronic
1048176185 8:132154622-132154644 GGATGATGGGGTGGGGCTGCAGG + Intronic
1048254947 8:132898565-132898587 AGAAGAGGGGTTGGGGCTGCAGG - Intronic
1048783370 8:138024962-138024984 AGCTGAGGAGTTGGGGCATAGGG - Intergenic
1049445191 8:142626985-142627007 GGGTGAGGAGATGGGGCTGCAGG - Intergenic
1049534244 8:143170776-143170798 AGCCTTTGGGTTGGGGCTGCAGG - Intergenic
1050673153 9:8020527-8020549 AGCTGATGAGTGTGGGATGCTGG - Intergenic
1051339986 9:16102265-16102287 AACTGAGATGTTGGGGCTGCAGG - Intergenic
1056486855 9:87067424-87067446 AGATGATGTGTTGTGGCTGTGGG + Intergenic
1057949402 9:99357802-99357824 GGGTGGTGAGGTGGGGCTGCTGG - Intergenic
1058186195 9:101858288-101858310 AGCTCACGTGTAGGGGCTGCTGG + Intergenic
1059305886 9:113352759-113352781 AGCTGGGGGGTTGGGGGTGCAGG + Intronic
1062209994 9:135358361-135358383 AGCCTAGGAGGTGGGGCTGCCGG + Intergenic
1190213569 X:48466396-48466418 AGCTGGGGAGTTGGGGCTTGGGG + Intronic
1190304321 X:49073576-49073598 GGCTGATGAGGAGGGCCTGCGGG - Intronic
1192360360 X:70435065-70435087 AGCTGAGAGGTTGGGGCTGCAGG - Intergenic
1196042364 X:111218695-111218717 GGCTTAAGAGTTGGGGCTGTAGG + Intronic
1197294473 X:124701254-124701276 AGCTGAAGAGTAGGGGTTTCTGG - Intronic
1199280252 X:145992697-145992719 AGGCGATGAGTTGGAGTTGCTGG - Intergenic
1199600673 X:149539745-149539767 AGCAGATGGGGCGGGGCTGCGGG - Intergenic
1199649869 X:149940045-149940067 AGCAGATGGGGCGGGGCTGCGGG + Intergenic
1199766363 X:150944510-150944532 AGCTGATGAGGTGTGGTTCCCGG - Intergenic
1200052888 X:153444264-153444286 GGCTGATGGGTTGTGGCTGTGGG - Intergenic
1200961264 Y:8998200-8998222 ATCTGATGAACTGGGGGTGCAGG - Intergenic
1201446736 Y:14064992-14065014 TGCTGAGGAGTTGGGACTACAGG - Intergenic
1201984259 Y:19947521-19947543 AACTGATGAGATGGGGTTGATGG + Intergenic