ID: 1036750474

View in Genome Browser
Species Human (GRCh38)
Location 8:11440542-11440564
Sequence GACCCAGCACTGCCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750469_1036750474 28 Left 1036750469 8:11440491-11440513 CCTTTTAGCTGGTCTTGCAGGAG 0: 1
1: 0
2: 0
3: 25
4: 362
Right 1036750474 8:11440542-11440564 GACCCAGCACTGCCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750474 Original CRISPR GACCCAGCACTGCCTGCCTC TGG Intronic
No off target data available for this crispr