ID: 1036750790

View in Genome Browser
Species Human (GRCh38)
Location 8:11442747-11442769
Sequence GGAGAAGATGAGGCACCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750790_1036750795 17 Left 1036750790 8:11442747-11442769 CCCGCAGGTGCCTCATCTTCTCC 0: 1
1: 0
2: 4
3: 38
4: 415
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750790 Original CRISPR GGAGAAGATGAGGCACCTGC GGG (reversed) Intronic
900103751 1:973634-973656 GGAGGAGGTCAGGCCCCTGCTGG + Exonic
900175904 1:1291247-1291269 AGAGCAGCTGCGGCACCTGCGGG - Exonic
900369491 1:2324980-2325002 GGAGCATCGGAGGCACCTGCCGG - Intronic
900622530 1:3593845-3593867 GGAGGAGATGGGGCCACTGCTGG - Intronic
900635349 1:3662137-3662159 GGTGGAGACCAGGCACCTGCTGG + Intronic
900787798 1:4659626-4659648 GGATAAGATCAGGCACCAGGAGG + Intronic
900886448 1:5418757-5418779 GAAGAAGCTGAAGCACCCGCAGG - Intergenic
901390944 1:8945679-8945701 GGAGGAGATCAGGCAGGTGCTGG + Intergenic
901883304 1:12206550-12206572 GGGGAAAATGAGGCACATGCAGG + Intronic
902246219 1:15122582-15122604 GGGAAAGAGGAGGCCCCTGCCGG - Intergenic
902561916 1:17282926-17282948 GGAGAAGGTGCGGTCCCTGCTGG + Exonic
902696518 1:18144182-18144204 GGAGGAGCAGAGGCTCCTGCTGG - Intronic
902877586 1:19350067-19350089 GGAGGAGGAGAGGCGCCTGCTGG - Intronic
903276101 1:22222817-22222839 GGAGAAGATGAGGCCCCGAGAGG - Intergenic
903744532 1:25577660-25577682 GGAGCATTTGAGGCACCTGGCGG + Intergenic
903794538 1:25918870-25918892 GGAGAAGAGGCGGCACCAGAGGG + Intergenic
903822377 1:26112118-26112140 CGAGGAGTTGAGGCAACTGCAGG + Intronic
903889786 1:26561718-26561740 AGAGAACATGAACCACCTGCTGG + Intronic
904269791 1:29342438-29342460 GGAGAATGTCAGCCACCTGCAGG - Intergenic
904810284 1:33159139-33159161 GTAGAAACTGAGGCTCCTGCTGG - Intronic
905304775 1:37009933-37009955 GGAGAAGAGGAGGCAAGTACTGG + Intronic
905886823 1:41496225-41496247 GGAGAGGGAGAGGCAGCTGCAGG - Intergenic
906184742 1:43853180-43853202 GGAGAAAGTGAGGCACCTACAGG + Intronic
906371147 1:45254934-45254956 GGAGAAGATGTGGGTCATGCAGG + Intronic
908441760 1:64162308-64162330 TGAGAAGAAGAGGCTCCTGTGGG + Intronic
909520886 1:76566450-76566472 GTAGGAGATGAGGAACCTGCAGG - Intronic
912510721 1:110188567-110188589 GGACAGGATGGGGCAGCTGCAGG - Intronic
913071366 1:115301986-115302008 GGACAAGTTTAGGCATCTGCTGG + Intronic
913088780 1:115461976-115461998 GGAGAAGATGCTCCTCCTGCAGG + Intergenic
914021243 1:143869937-143869959 GCAGTAGATGAGGCAATTGCAGG + Intergenic
914900725 1:151709799-151709821 AGAGAAGAGAAGGCAGCTGCTGG + Intronic
915120292 1:153626322-153626344 TGAGCAGATGGGGCAACTGCTGG + Exonic
915162512 1:153930362-153930384 GGAGGAGCTGAGGCACCGGCGGG - Exonic
915315030 1:155023657-155023679 GGAGAAAATGAGCTACCTGAAGG + Intronic
917241107 1:172949651-172949673 GGAGGAGATGAGCCACTTCCAGG + Intergenic
918898550 1:190381088-190381110 GGGAGAGATGAGGCTCCTGCAGG - Intronic
922218470 1:223539768-223539790 GGAGGAGATGTGGCCCCTGCAGG - Intronic
922359145 1:224805060-224805082 TGTGAAGAAGAGGGACCTGCAGG + Intergenic
922920062 1:229294503-229294525 GGTGAAGAAGAGGAAGCTGCAGG + Intronic
923873390 1:238020517-238020539 GGAGAAGATAAGGCATGTGATGG - Intergenic
924017599 1:239744463-239744485 GGAGAAGTTGAGGGAGCGGCCGG + Intronic
1062768492 10:82452-82474 GGAGGAGGTGAGGCACATGGTGG + Intergenic
1062968809 10:1630280-1630302 GGAGAAGATGACACTCGTGCAGG + Intronic
1064491313 10:15860294-15860316 GGACATGATGAGGAACCGGCGGG + Exonic
1064834018 10:19505048-19505070 GGAGAAGATGAGGGAGGAGCTGG + Intronic
1069426617 10:68294247-68294269 GGATAAGATGAAGCATCTGTGGG - Intronic
1069586983 10:69613362-69613384 AGAGAAGCTGAAGTACCTGCAGG - Intergenic
1069706113 10:70459882-70459904 GGAGAAGGTGCGGCAGCTGGAGG - Intergenic
1070282774 10:75061967-75061989 GGAGAAGGTGAGGGGACTGCAGG + Intergenic
1070942996 10:80362956-80362978 GGAAAAGAAGATCCACCTGCAGG + Exonic
1071505522 10:86229277-86229299 GGAGCAGCTAAGGCACCTGCTGG + Intronic
1072448790 10:95522203-95522225 GGAGAAAAGGAGGCACCTTTCGG - Intronic
1073302585 10:102480146-102480168 GGAGAGTTTAAGGCACCTGCTGG - Exonic
1073571256 10:104582828-104582850 GGAGTTGCTGAGGCAGCTGCAGG + Intergenic
1075452118 10:122558560-122558582 GGACAAGATGAGGCACCTGACGG + Intergenic
1075575409 10:123573872-123573894 GGAGAAGAGGAGGCAGAGGCTGG - Intergenic
1076473474 10:130736288-130736310 GGAGGAGAGGAGGCTCATGCAGG + Intergenic
1076670279 10:132117184-132117206 GGAGAAGATGAAGGAGCTACAGG + Exonic
1077186830 11:1239277-1239299 GGGGAAGGTGAGGCACCACCCGG + Intronic
1077226649 11:1441614-1441636 GGAGGGGATGATGCACCTGAGGG - Intronic
1077226731 11:1441906-1441928 GGAGGGGATGATGCACCTGAGGG - Intronic
1077240699 11:1508953-1508975 GGAGAAAATGCGTCACATGCGGG + Intergenic
1077353948 11:2106088-2106110 GGAGAAGTGGAGGCACCTGCTGG - Intergenic
1077757051 11:5042810-5042832 TGAGTAGATGAGGCAGCAGCAGG + Intergenic
1078829960 11:14969467-14969489 GGTGAAGGTGAGGCCCTTGCAGG - Intronic
1078841035 11:15075682-15075704 GGTGAAGATGAAGCCCTTGCAGG + Intronic
1079366288 11:19813198-19813220 GCAAAAGATGAGGCACATGGAGG + Intronic
1079920597 11:26429232-26429254 GGAGAAGATGAGAGTGCTGCAGG + Intronic
1080691810 11:34564735-34564757 GGGAAAGGAGAGGCACCTGCAGG + Intergenic
1081853047 11:46287030-46287052 GCAGATGATGAGGCAAGTGCTGG + Intronic
1083148510 11:60775716-60775738 GTAGCAGATGTGGCACCTGCGGG + Exonic
1084409136 11:68996497-68996519 AGAGAAGCTGAGACACTTGCTGG + Intergenic
1085234851 11:75006420-75006442 GGAGATCCTGAGTCACCTGCAGG + Exonic
1085895924 11:80639297-80639319 GGTGAATATGAGGAACCTGTTGG - Intergenic
1089282980 11:117387323-117387345 AGAGAAGATGCAGCAACTGCGGG + Exonic
1089649082 11:119900501-119900523 GGAGGAGATGGGGCAATTGCTGG - Intergenic
1090040989 11:123291343-123291365 GGGGAAGGTGAGGGAGCTGCAGG + Intergenic
1090334928 11:125955646-125955668 GAAGATGCTGAGGCACCGGCAGG + Intergenic
1091218819 11:133918984-133919006 AGAGAAGAAGAGGCACAGGCAGG + Intronic
1094818095 12:34205716-34205738 AGAGAAGATCAGGCGCCTTCAGG - Intergenic
1095246812 12:39932892-39932914 GGAGAAGATGGGGGACAAGCAGG + Intronic
1095273128 12:40244901-40244923 GGAGATGAAGAGGTAGCTGCAGG + Intronic
1096081171 12:48833549-48833571 AGAAAAGAAGGGGCACCTGCTGG - Intronic
1096464540 12:51841065-51841087 GGAGGGGCTGAGGCAGCTGCTGG - Intergenic
1096849635 12:54427349-54427371 GGCGGAGAGGAGGCACCTGAGGG - Intergenic
1097141750 12:56908347-56908369 GGCCAGGATGAGTCACCTGCTGG + Intergenic
1098016100 12:66106612-66106634 AGAGAAGGTAAGGCACCTCCAGG - Intergenic
1098461430 12:70736972-70736994 GGAGAGGATGGGGCACCAGCTGG - Intronic
1099057574 12:77864249-77864271 TGAGAAGATGAGGGACTTACAGG - Intronic
1099846582 12:88035410-88035432 GCAGAAGCTGAGGCGCCTGGTGG - Intronic
1100574741 12:95880063-95880085 GCAGAAGAGGAGGCAAGTGCGGG + Intronic
1101183166 12:102242074-102242096 GGATAAGAGGAGGCATTTGCTGG - Intergenic
1101671886 12:106883252-106883274 GGAGAAGAGGGAGAACCTGCTGG - Intronic
1101716872 12:107319554-107319576 GGAGAAGGTGAGGCCGCAGCGGG - Exonic
1103527870 12:121579611-121579633 TGGGGAGATGAGGCAGCTGCTGG - Intronic
1104000146 12:124855044-124855066 GGAGATGAGGAGGCATCAGCAGG + Intronic
1104778336 12:131404284-131404306 GGAGAAACTGAGGCACATGGGGG - Intergenic
1104908686 12:132229165-132229187 GGAGGAGCAGAGGCAGCTGCAGG - Intronic
1105611766 13:21974944-21974966 AGCGGAGATGAGGCACATGCAGG + Intergenic
1105849775 13:24323370-24323392 CGAGAACTTGAGGCCCCTGCTGG + Intergenic
1106642450 13:31598508-31598530 GAAGAGCATGAGGTACCTGCTGG - Intergenic
1108174348 13:47777061-47777083 AGAAAAGATCAGGAACCTGCGGG + Intergenic
1108185708 13:47886617-47886639 GGAGGAGATGAGGCACCAACCGG + Intergenic
1108376120 13:49815702-49815724 GGAGAAGACTAGGCTTCTGCTGG + Intergenic
1108681335 13:52783201-52783223 GGAGAAGATGGAGCAGCTCCAGG - Intergenic
1109494287 13:63147567-63147589 GGTGAAGATGAGGAACTTGTTGG - Intergenic
1111479619 13:88807228-88807250 GGAGAAGATGAGAAAGCAGCAGG + Intergenic
1111799150 13:92960775-92960797 GGTGGAGATGAGGAACTTGCTGG - Intergenic
1111882613 13:93976775-93976797 GGAGAAGGACAGCCACCTGCAGG + Intronic
1113605515 13:111602331-111602353 GAAGAAGATGTGGCAGCCGCAGG - Intronic
1113693920 13:112330792-112330814 GGAGAAGAGGAGGCACCCACAGG - Intergenic
1114654876 14:24310111-24310133 GGACAAGATGAGGCTCATCCTGG - Intronic
1116426297 14:44795938-44795960 GGTGGACATGAGTCACCTGCTGG + Intergenic
1117175435 14:53141337-53141359 AGTGAAGATGAGGCAGCTTCTGG + Intronic
1118682020 14:68251589-68251611 GGAACAGATGTGACACCTGCAGG - Intronic
1119433581 14:74583921-74583943 GGAGGAGGTGAGGCCCCTGCCGG - Intronic
1120521958 14:85534215-85534237 CTACAAGATGAGGCACCAGCTGG - Intronic
1121818612 14:96947147-96947169 GGATATGATGTGGCCCCTGCTGG - Intergenic
1122048422 14:99039415-99039437 GGGGAAGAGGAGGCCCCTGGGGG + Intergenic
1122508954 14:102250424-102250446 TGTGAGGATGAGGCACCTTCTGG - Intronic
1122812840 14:104297493-104297515 GGAGAAGAGGACCCATCTGCCGG + Intergenic
1122985406 14:105209452-105209474 GGGGAGGATGAGGCCCCTGGGGG + Exonic
1124610862 15:31207383-31207405 GCAGAAGATGAGGGAGCTTCCGG + Intergenic
1125743509 15:41983771-41983793 GGAGAAGAAGAAGCGCCTGAAGG - Exonic
1126105601 15:45145029-45145051 GGAGCAGCGGAGGCACCTCCTGG + Exonic
1126287781 15:47034293-47034315 GGAGGAGATGATGCAACTGTAGG + Intergenic
1127335609 15:57980283-57980305 TGGGAACATGAGGCACATGCAGG - Intronic
1128130528 15:65224289-65224311 GTTGAAGATGAGGCCCCTGGTGG - Intergenic
1128375337 15:67070291-67070313 TGAGAAGAGGAGGTGCCTGCAGG + Intronic
1129606062 15:77025598-77025620 GAAGAAGGTGAGGCAGGTGCAGG + Exonic
1129776176 15:78237843-78237865 GGGGATGGTGAGGCAGCTGCAGG - Intronic
1130917138 15:88313997-88314019 GGATTAGTTCAGGCACCTGCTGG - Intergenic
1131833318 15:96368025-96368047 GGAGGAGCTTAGGCAACTGCTGG - Intergenic
1132457363 16:31476-31498 GGAGGAGGTGAGGCACATGGTGG + Intergenic
1132751128 16:1458203-1458225 GGAGAGGATGAGGCCCCTGGGGG - Intronic
1132803994 16:1767321-1767343 GGAGGGGAAGAGGCTCCTGCTGG + Intronic
1133481990 16:6179645-6179667 GGAGAAGGAGAGGCAGCAGCAGG - Intronic
1133716387 16:8453402-8453424 GGAGAAGGTGAGGGCTCTGCAGG + Intergenic
1134166433 16:11933732-11933754 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1134494280 16:14719997-14720019 GGAGAAGGTGAGAAACCTGAGGG - Intronic
1134499661 16:14759117-14759139 GGAGAAGGTGAGAAACCTGAGGG - Intronic
1134526209 16:14945744-14945766 GGAGAAGGTGAGAAACCTGAGGG - Intronic
1134546199 16:15110629-15110651 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1134580915 16:15369927-15369949 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1134713787 16:16344215-16344237 GGAGAAGGTGAGAAACCTGAGGG - Intergenic
1134721657 16:16387569-16387591 GGAGAAGGTGAGAAACCTGAGGG - Intronic
1134843043 16:17416611-17416633 GGAGGAGCTGCGGCTCCTGCTGG + Intronic
1134945769 16:18324306-18324328 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1134953030 16:18364442-18364464 GGAGAAGGTGAGAAACCTGAGGG + Intergenic
1135311824 16:21411149-21411171 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1135354562 16:21758350-21758372 GGTGAACATGAGGCAGGTGCTGG + Intronic
1135447067 16:22527736-22527758 GGAGAAGGTGAGAAACCTGAGGG - Intronic
1135453052 16:22574490-22574512 GGTGAACATGAGGCAGGTGCTGG + Intergenic
1136169816 16:28482217-28482239 GGAGGAGAGGAGGCTCCTCCAGG + Intronic
1136308528 16:29390156-29390178 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1136321943 16:29491682-29491704 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1136436624 16:30231655-30231677 GGAGAAGGTGAGAAACCTGAGGG + Intronic
1136737517 16:32477214-32477236 TGAGAAGAAGTGGCTCCTGCAGG - Intergenic
1137708951 16:50553473-50553495 GGAGAAGATGAGGAGGGTGCAGG + Intronic
1138293951 16:55870964-55870986 GGAGAAGACGAGGCACAGGAAGG - Intronic
1138316082 16:56071602-56071624 GGAGGAGATGACCCTCCTGCTGG + Intergenic
1138349659 16:56339719-56339741 GGAGAAGCTGTGGCAGCCGCAGG - Intronic
1139856229 16:69982565-69982587 GGAGAAGGTGAGAAACCTGAGGG + Intergenic
1140906219 16:79411507-79411529 GCAGAAGATGAGAGCCCTGCAGG + Intergenic
1141630705 16:85286388-85286410 AGGGGAGATGAGGCACCAGCCGG - Intergenic
1142292572 16:89199756-89199778 GGAGCAGGTGAGCCACCTCCTGG - Exonic
1203015554 16_KI270728v1_random:352363-352385 TGAGAAGAAGTGGCTCCTGCAGG + Intergenic
1203033889 16_KI270728v1_random:625521-625543 TGAGAAGAAGTGGCTCCTGCAGG + Intergenic
1142848776 17:2694506-2694528 GCAGAAGATAACGCTCCTGCGGG - Exonic
1144662172 17:17078212-17078234 GAAGAACTTGTGGCACCTGCTGG + Intronic
1144676868 17:17167633-17167655 GGAGGAGCTGAGGACCCTGCAGG + Intronic
1145295873 17:21592563-21592585 GCAGAAGCTGAGGCCCCTGACGG + Intergenic
1146260498 17:31417264-31417286 GGAGGAGGTGAGGCAGGTGCTGG - Intronic
1146409147 17:32567025-32567047 GGAGCAGATGATGCGGCTGCAGG + Intronic
1146570473 17:33948344-33948366 TGACAAAATGAGGCTCCTGCGGG - Intronic
1147598429 17:41731664-41731686 GGAGAAGCTGAGGCTGCTGGAGG - Exonic
1148051812 17:44773234-44773256 GGAGAAGATGAGGGGGCTGGAGG - Intronic
1148069938 17:44902766-44902788 GGAGGAGGAGAGGCTCCTGCAGG + Exonic
1148086475 17:44996585-44996607 GGATAAGATGTGGCTCCTGATGG + Intergenic
1148443108 17:47721839-47721861 GGAGGGGATGAGGCAGCTGGTGG + Intergenic
1151246384 17:72798127-72798149 GGAGGAGAGGAGGCAACTTCAGG + Intronic
1151764513 17:76125251-76125273 GGAGAAGATGAGGGATGAGCAGG + Intergenic
1152103382 17:78315562-78315584 GGAGCAGTGGAGTCACCTGCAGG + Intergenic
1152228177 17:79102248-79102270 GGAGAAGACGAGGCATGTGTGGG + Intronic
1152314306 17:79571409-79571431 GGAGAGGATATGGCACCCGCAGG - Intergenic
1152645558 17:81467038-81467060 GGAGCAGATGAGGCCCTGGCCGG + Intergenic
1152879748 17:82808279-82808301 GGAGGAGAGGAGGCAGGTGCAGG + Intronic
1152879764 17:82808341-82808363 GGAGGGGATGAGGCAGGTGCAGG + Intronic
1152879784 17:82808402-82808424 GGAGAGGATGAGGCAGGTGCGGG + Intronic
1152879890 17:82808705-82808727 GGAGGGGATGAGGCAGGTGCAGG + Intronic
1152961381 18:82285-82307 GGAGGAGGTGAGGCACATGGTGG + Intergenic
1154117701 18:11625791-11625813 GGAGAAGGTGAGAAACCTGAGGG + Intergenic
1154121212 18:11654105-11654127 GGAGCAGAAGAGGCAGGTGCAGG - Intergenic
1154132019 18:11745551-11745573 GGAAAAGACTAGGCACCAGCGGG - Intronic
1155101593 18:22615826-22615848 GGGGGAGATGAAGCAGCTGCTGG - Intergenic
1155343475 18:24836169-24836191 GGAGCAGATGAGGCATGAGCAGG + Intergenic
1155585769 18:27362598-27362620 GGGGAAAATGAGGCCCCAGCAGG - Intergenic
1155781114 18:29837361-29837383 GATGAAGATGAGGAACTTGCTGG + Intergenic
1155865180 18:30956164-30956186 GGAGAAGAGGAGGAACCTTGAGG - Intergenic
1156498021 18:37538613-37538635 AGAGCAGAGGAGGCACCTGAGGG - Intronic
1156832907 18:41516457-41516479 GGGGAAGATGAAGCAGCTGCAGG - Intergenic
1157805325 18:50653641-50653663 GGAGGAGAATGGGCACCTGCAGG + Intronic
1158520692 18:58169792-58169814 GGAGGAGATGAGGACCCAGCTGG - Intronic
1158542497 18:58369732-58369754 GGTGAAATGGAGGCACCTGCAGG + Intronic
1160659113 19:290260-290282 GGAGGTGCTGAGTCACCTGCCGG - Intronic
1160904243 19:1445104-1445126 GGTTCAGCTGAGGCACCTGCTGG + Intergenic
1161034906 19:2079198-2079220 GGGGAAGATGCGGCCCCTGCGGG - Intronic
1161477421 19:4494259-4494281 GGAGGAGCTGCGGCGCCTGCGGG + Exonic
1161766461 19:6211488-6211510 GGACAAGATGAGGGACCTCAGGG + Intergenic
1162620586 19:11840440-11840462 TGAGTAGCTGGGGCACCTGCAGG - Intergenic
1163696978 19:18768983-18769005 GGAGAAACTGAGGCACGAGCAGG + Intronic
1165013338 19:32864175-32864197 GGAGAAGCTGAGGCAGATGATGG + Exonic
1165864221 19:38926267-38926289 GCAGGAGCTGAGGCAGCTGCAGG - Exonic
1166433079 19:42742521-42742543 GGAGAAGAAGAGGGAGCAGCAGG + Intronic
1167110829 19:47460044-47460066 GGAGAAGTGGAGGCACCCCCAGG - Intronic
1167285949 19:48599110-48599132 GGAGAAGAGGGGGCACCAGGGGG - Intronic
1167843274 19:52139458-52139480 GGAGAAGAAGCGGCTCCTTCAGG + Intronic
1167908631 19:52683477-52683499 GGAGAAGGTCAGGGACCTGAGGG - Intronic
1167939777 19:52937356-52937378 GGAGAAGGTCAGGGACCTGAGGG - Intronic
1167944686 19:52978689-52978711 GGAGAAGGTCAGGGACCTGAGGG - Intergenic
1167988526 19:53338479-53338501 GGAGAAGGTCAGGGACCTGAGGG + Intronic
1168181500 19:54665290-54665312 GGAGAAACTGAGGCCCATGCAGG - Intronic
1168337904 19:55606566-55606588 GAAGAGGATGAGGCACATTCTGG - Intronic
1168375429 19:55874055-55874077 GGAAAAGATCAGAAACCTGCAGG + Intronic
1168484076 19:56746169-56746191 GGAGAATATAAGGCATCAGCTGG - Intergenic
925273867 2:2635431-2635453 GGAGCAGCAGAGTCACCTGCTGG - Intergenic
926149759 2:10418812-10418834 GGGAAAAATGAGGCACCTGTGGG - Intronic
926484041 2:13433006-13433028 AGAGGAGATGAGGCACTTGTTGG - Intergenic
926739714 2:16101265-16101287 GGAGAAGATGGGTGTCCTGCAGG + Intergenic
927217365 2:20675583-20675605 GCAGAAGATGAAGCTCCAGCAGG - Intergenic
927509486 2:23635472-23635494 GCAGAGGGGGAGGCACCTGCTGG - Intronic
927521230 2:23699556-23699578 GGACAACAGGAGGCAGCTGCTGG - Intronic
929945449 2:46368247-46368269 GGAGAAGATGAGGCTTTAGCTGG + Intronic
930536797 2:52653743-52653765 GGTGAAGCTGAGTCACCTGGAGG - Intergenic
931078549 2:58743374-58743396 GGACAAGATGAGGCACCAGCTGG + Intergenic
931245520 2:60489578-60489600 GTAGAAGAGGAAGCACCTGAAGG + Intronic
931263260 2:60638445-60638467 GGCCAAGAGGAGGCACCAGCAGG - Intergenic
931517107 2:63056395-63056417 GGAGAAGACGAGGCAAAGGCGGG - Exonic
931996664 2:67845448-67845470 GCTGAAGATGAGGAACCAGCAGG - Intergenic
932457639 2:71859574-71859596 AGAGCAGATGAGGGAACTGCTGG + Intergenic
932736854 2:74260380-74260402 GGAGAGGCTGAGGCACCTGGAGG - Intronic
932827940 2:74958716-74958738 CGAGAGGAGGAGGGACCTGCTGG + Exonic
934188650 2:89766327-89766349 TGAGAAGAAGTGGCTCCTGCAGG - Intergenic
934560005 2:95308296-95308318 GGAGAAGGGGAGGGACGTGCAGG + Intronic
934614696 2:95763892-95763914 GGGGAAGAGGAGGCAGCTGTGGG + Intergenic
934839611 2:97616686-97616708 GGGGAAGAGGAGGCAGCTGTGGG - Intergenic
935815675 2:106843818-106843840 GGAGACCAGGAGGCTCCTGCCGG - Exonic
936060890 2:109295157-109295179 GGAGAGGGGCAGGCACCTGCAGG - Intronic
937147044 2:119656413-119656435 CGAGGAGATGAGGAACCTGCGGG + Exonic
937867905 2:126767726-126767748 GCACAAGAGGAGGCACCTCCTGG + Intergenic
940517414 2:154698593-154698615 GGAGAAGGAGAGGCGTCTGCAGG + Exonic
941452072 2:165671968-165671990 GATGAAGATGAGGAACCTGTTGG - Intronic
942877847 2:180823882-180823904 GGGGAAGATGGAGCAGCTGCAGG - Intergenic
945707866 2:213258130-213258152 AGAGAAGATCAGGCACATTCAGG - Intergenic
946762286 2:223006390-223006412 TGAGGAGATGAGGGACCTGAGGG + Intergenic
947077088 2:226356322-226356344 GGAGAATAAGAGGCAGCTGCAGG - Intergenic
947162250 2:227226337-227226359 GGAGAAGGGGAGGCACATGGGGG + Intronic
947384981 2:229581983-229582005 AGAGAAGCTGAGGCACTTTCAGG - Intronic
948231200 2:236350842-236350864 GGGGAAGCTGAGGGGCCTGCTGG + Intronic
948232134 2:236356348-236356370 TGAGAAGATGAAGCAACTGAAGG - Intronic
948232310 2:236358972-236358994 TGAGAAGATGAAGCAACTGAAGG + Intronic
948311701 2:236992061-236992083 GGAGAAGCTGAGGCCACTGGGGG - Intergenic
948785347 2:240349651-240349673 GGAGGACATGAGGCTCCAGCGGG - Intergenic
948829179 2:240589447-240589469 GCAGAAGAGCAGGCACCTCCTGG + Exonic
948854395 2:240723415-240723437 GGAGAAGCTGAGCCTCCTGCAGG - Exonic
1169141213 20:3228341-3228363 GCAGCAGCTGAAGCACCTGCAGG + Exonic
1170568930 20:17622088-17622110 GGAGAAGATGAGGCTCCATGGGG + Intronic
1172077592 20:32311088-32311110 GGAGAAGATGAGGCTGCTGAAGG + Exonic
1172156226 20:32826849-32826871 GCAGAAGATGGTGGACCTGCAGG - Intronic
1172517769 20:35547378-35547400 GGAGAAGCAGAGGCATCAGCTGG - Intronic
1174203932 20:48826254-48826276 GGAGTAAATGAGGCCCCAGCAGG + Intronic
1175815851 20:61882865-61882887 AGAGAAGGAAAGGCACCTGCGGG - Intronic
1175867918 20:62191234-62191256 GGACAAGGTGTGGCAGCTGCAGG + Intronic
1175940452 20:62535346-62535368 GGGGAGGAGGCGGCACCTGCAGG + Intergenic
1176031540 20:63015379-63015401 GGATGAGATGAGGCAGCTGCAGG + Intergenic
1176066979 20:63203024-63203046 GGAGAGGCTGAGCCACCTGCTGG + Exonic
1176160328 20:63644280-63644302 GGAGAAGATGAAGGAGCTGTCGG - Exonic
1176994699 21:15541932-15541954 TGAGAAGTTGAGGCAACTGAGGG + Intergenic
1179093026 21:38285612-38285634 GGAGAAAATGAAGAACCTTCAGG + Intronic
1179560813 21:42215088-42215110 GGAGAAGCAGAGGGATCTGCAGG + Intronic
1180190657 21:46161025-46161047 GGGGAAGAGGGGGCCCCTGCCGG + Intergenic
1180535032 22:16388709-16388731 TGAGAAGAAGTGGCTCCTGCAGG + Intergenic
1181089098 22:20459903-20459925 TAAGAAGATGAGTGACCTGCTGG + Intronic
1181530564 22:23514727-23514749 GGAGAAGCTGAGGCCCAAGCAGG + Intergenic
1181639995 22:24191305-24191327 GGAGCCGATGAGGTACCAGCAGG + Intergenic
1183520647 22:38294456-38294478 GGAGAGGATGGGGCAGCTACGGG - Exonic
1183596391 22:38815028-38815050 GGAGATGAGGAGGCACCAGAAGG + Intergenic
1183697227 22:39430311-39430333 GCAGAGGATGGGGCACCTGCTGG - Exonic
1183708095 22:39487391-39487413 GAAGGAGATGAGGCACAGGCCGG - Exonic
1184112044 22:42401310-42401332 GGAGGAGATGAGCCACAGGCTGG + Intronic
1184242199 22:43217121-43217143 GGAGAAGAGGTGACACCTGGCGG - Intronic
1184787432 22:46678582-46678604 GGACAAGCTGAGGGAGCTGCGGG - Exonic
1184987266 22:48144419-48144441 GGAGATGTGGAGGGACCTGCAGG + Intergenic
1185024289 22:48398779-48398801 GGAGAAGGCCAGGCCCCTGCTGG - Intergenic
1185344636 22:50305932-50305954 GGAGAAGATGCGTCACCTTTGGG - Intronic
949328715 3:2896839-2896861 GGAGAAGATGAATCATCTCCAGG - Intronic
950744331 3:15074657-15074679 GGAGAACCTGCGGCAGCTGCAGG - Exonic
950861505 3:16151321-16151343 GGAGAAGATAAAGCACTTGCAGG - Intergenic
952347736 3:32504064-32504086 GGAGAAGATGTAGCAGCTGATGG - Intergenic
952899136 3:38098037-38098059 GGAGAACAGGAGGCACCGCCAGG - Intronic
953024605 3:39137614-39137636 GGAGAAGAGCTGGCTCCTGCTGG + Exonic
953239693 3:41137752-41137774 GGAGATGATGATTCACATGCAGG + Intergenic
954444057 3:50537197-50537219 GCAGAGGCTGAGGCACCTTCGGG + Intergenic
956532128 3:70232293-70232315 GTTGAAGATGAGACACTTGCTGG - Intergenic
957160394 3:76602082-76602104 GATGGAGATGAGGAACCTGCTGG - Intronic
958901536 3:99892936-99892958 AAAGAAGATGAGGCCCCTGTTGG + Intronic
960043067 3:113169996-113170018 GGAGAACAAGAGGCAGCTGCAGG + Intergenic
960988128 3:123293438-123293460 TGGGAAAATGAGGGACCTGCTGG + Intronic
961459147 3:127039299-127039321 GGAGACCAAGAGGCTCCTGCAGG + Intergenic
962053425 3:131843237-131843259 GGGGAAGAGGAGGCAGTTGCTGG + Intronic
963044562 3:141093125-141093147 GTGGAAGATGGGGCAGCTGCAGG + Intronic
963283860 3:143413526-143413548 GGAGAAGGGGAGGCAGCTGGCGG + Intronic
963339855 3:144020784-144020806 GATGAAGATGAGGAACTTGCTGG - Intronic
964594082 3:158402050-158402072 GGAGAAGATGATGCAAGAGCTGG + Intronic
965034615 3:163422844-163422866 GGTGAAGGTGAGACACCAGCTGG + Intergenic
965181904 3:165414941-165414963 GGAGAAGATATGGGCCCTGCTGG - Intergenic
965597947 3:170426106-170426128 AAAGAAGATGAGGCACCTCCTGG + Intronic
968084440 3:195868095-195868117 GGAGTGCATGAGGCAACTGCAGG - Exonic
968631281 4:1653458-1653480 GGAGCAGAGGAGGGAGCTGCCGG - Intronic
968842479 4:3017610-3017632 GGAGGAGAGGAGGCCCCAGCCGG - Intronic
968886205 4:3334825-3334847 GAAGAAGATCAGGCAGATGCGGG + Intronic
969259435 4:6024143-6024165 AGAGATGCTGAAGCACCTGCAGG - Intergenic
969330551 4:6471696-6471718 GGAGAAGAAGAGGGACCCGGGGG - Intronic
969538783 4:7772963-7772985 GGAGAAGCTGAAGCAGCTGGAGG - Exonic
970223210 4:13831481-13831503 GGAGAAGTAAAGGCAGCTGCAGG - Intergenic
972686664 4:41359675-41359697 AGAGGAGATGAGGAACCTTCTGG + Intronic
974246390 4:59324846-59324868 AGAGAAGATTAGGGAACTGCAGG - Intergenic
974697358 4:65393460-65393482 GGAAGAGATCAGGCAACTGCTGG - Intronic
976211974 4:82680814-82680836 GGAGAAGAAGAAGCCCCGGCGGG + Exonic
980184158 4:129440874-129440896 GGAGAAGAGGAGAGACCTGGTGG - Intergenic
981073574 4:140569217-140569239 ACAGAAGGTGAGGCACGTGCGGG - Intergenic
981719508 4:147787388-147787410 GGAGAAGATGAAGCTCATGAAGG + Intronic
985843144 5:2324629-2324651 CGTGAAGATGAGGCCCCAGCCGG + Intergenic
986287523 5:6370830-6370852 AGAGTAGAGGAGGCCCCTGCTGG - Intergenic
986651185 5:9964666-9964688 GGAGGGGAACAGGCACCTGCAGG + Intergenic
987490064 5:18568627-18568649 GGACAAGATCAGGCACATTCAGG - Intergenic
987685074 5:21187141-21187163 GGATAAGATCAGACGCCTGCAGG + Intergenic
988926735 5:35997761-35997783 GGAGAAGATCATGCACATACTGG - Intergenic
992011292 5:72530354-72530376 GGAGAAGATGAAGGGCCTGCTGG + Intergenic
992099969 5:73397621-73397643 GGAGAAGATGGAGCAGTTGCTGG - Intergenic
992143467 5:73821976-73821998 GGAGAAGATGGGGAAACTGCAGG - Intronic
994236579 5:97369656-97369678 GGAGAAGCTGAAGCACCTTCTGG - Intergenic
995727843 5:115201479-115201501 GGAGAAGGTGAGGCTCATTCTGG - Intergenic
996460093 5:123732030-123732052 GAAGAAGATGAGGAACTTGTTGG + Intergenic
996753748 5:126915140-126915162 AGAGAAGGAGGGGCACCTGCTGG + Intronic
997668150 5:135648868-135648890 GGAGAAGACAAGGCACTAGCTGG + Intergenic
997861081 5:137417118-137417140 TGAAAAGATGAGACACCTGCTGG - Intronic
998376599 5:141694942-141694964 GGAGAAACTGAGGCAGCTGAGGG + Intergenic
998977188 5:147661316-147661338 GGAGAAGATGAAGGAGCTGCAGG - Exonic
999227813 5:150041801-150041823 GGAGGAGCTGAGCCAGCTGCAGG + Exonic
999719248 5:154386485-154386507 GCAGAAGCTGAGACACCTACTGG - Intronic
999742350 5:154565952-154565974 GGAGAAGCTGGGAGACCTGCTGG + Intergenic
1000253727 5:159518792-159518814 GGAGGTGATAGGGCACCTGCGGG + Intergenic
1000629013 5:163570704-163570726 GGAGAAACTGAGGCACATGGGGG + Intergenic
1001286178 5:170425683-170425705 GCAGAGGAAGAGGCACTTGCAGG - Intronic
1002535875 5:179875104-179875126 GGAGAAGATGCAGGACCTGGGGG - Exonic
1003615694 6:7653402-7653424 GGTGAAGATGTGTCACCTGTAGG - Intergenic
1004542452 6:16563734-16563756 TGAGGAGATGAAGCAACTGCAGG + Intronic
1005055835 6:21728122-21728144 GGGGACTATGAGGCACCTGGGGG - Intergenic
1005175111 6:23035861-23035883 AGAGAAGCTGATGCAGCTGCAGG + Intergenic
1005410085 6:25535419-25535441 GGGGAAGATATGGGACCTGCAGG + Intronic
1005986922 6:30881408-30881430 AGAAAGGAAGAGGCACCTGCGGG - Intronic
1006166796 6:32070091-32070113 GGAGCAGAGCAGGGACCTGCAGG + Intronic
1006259493 6:32855830-32855852 GGTGGAGATGAGGCTCCTACAGG - Intronic
1007121434 6:39385371-39385393 GGGGAGGATGAGGCAACAGCTGG + Intronic
1007238828 6:40410741-40410763 GCAGAAGATGAGCCGCCTGAGGG + Intronic
1009929679 6:70162643-70162665 GGAGAAGTTGAAGCATGTGCTGG - Intronic
1011064450 6:83310357-83310379 GGAGAAGTTGAGCTGCCTGCAGG - Intronic
1011528601 6:88295220-88295242 GGGGAAGACGAGGCACATGCAGG + Intergenic
1011629346 6:89309365-89309387 GGAGAAGCTGAGGAAGCTGTGGG - Intronic
1011807661 6:91090695-91090717 GGAGAGGATGAGGCATCTTTAGG + Intergenic
1012466100 6:99517820-99517842 GGGGAAGATGAGAAACCAGCAGG - Intronic
1012478293 6:99638288-99638310 GATGAAGATGAGGAACTTGCTGG - Intergenic
1013078130 6:106789116-106789138 GGAGAAGGTCAGGAACCAGCAGG + Intergenic
1013226588 6:108123407-108123429 GGGGAAGATGTGGGACCAGCTGG - Intronic
1013321453 6:108994552-108994574 GGAAAAGATGAGGCAGTTACAGG - Exonic
1013958970 6:115874924-115874946 GCAGAAACTGAGGCACATGCAGG - Intergenic
1014530383 6:122552322-122552344 GGAGATGCTGAGGAAGCTGCTGG - Intronic
1015185302 6:130408890-130408912 GGATCAGATGTGGCACCTACAGG - Intronic
1015271933 6:131345399-131345421 AGAGAAGGTGAGAGACCTGCAGG + Intergenic
1017340596 6:153317262-153317284 GCAGAAGTTGAGGCACCTGTGGG - Intergenic
1017719720 6:157236121-157236143 GGAGAAGAAGTGGCATCCGCGGG + Intergenic
1018471502 6:164101559-164101581 GGTGGAGAAGAGGGACCTGCAGG - Intergenic
1019310154 7:356618-356640 GCAGAAGGGGAGGCATCTGCAGG - Intergenic
1019709268 7:2510918-2510940 GGAGAAGATAAGGGACCGCCAGG + Intergenic
1021205363 7:17773540-17773562 GGAGAATTTAAGGCACCTGTAGG - Intergenic
1021594328 7:22298611-22298633 GGACAAGATCAGGCACCTTCAGG - Intronic
1023044448 7:36198976-36198998 GGAGAAGAAGAGGCTCTTTCTGG - Intronic
1023908635 7:44539031-44539053 GGAGAGGCTGCGGCACCTCCAGG - Exonic
1024404189 7:48959182-48959204 GGAGAAGAAGAAGCTGCTGCTGG - Intergenic
1024585182 7:50835928-50835950 GGACAACATGTGTCACCTGCTGG - Intergenic
1025234700 7:57226785-57226807 GCAAATGATGAGGCACTTGCAGG + Intergenic
1025635817 7:63318207-63318229 GCAGTTGATGTGGCACCTGCAGG - Intergenic
1025646879 7:63429973-63429995 GCAGTTGATGTGGCACCTGCAGG + Intergenic
1026664818 7:72333072-72333094 GGAGAATATGAGGAAGCAGCTGG - Intronic
1026953053 7:74360267-74360289 GGAGGAGAGGAGGTACGTGCTGG + Exonic
1029560257 7:101298205-101298227 GGAGAAGATGAGGGACCAGACGG - Intergenic
1031252730 7:119408736-119408758 GGAGAAAAGGAGGCCCCTGTGGG + Intergenic
1032079445 7:128851354-128851376 GGAGAAGGTGAGGGAGCTGCAGG + Exonic
1033257371 7:139813887-139813909 GGAGAGGAAGTGGCACCTGAGGG - Intronic
1034324775 7:150220501-150220523 GGAGAAGGAGAAGCAGCTGCTGG + Intergenic
1034768416 7:153748730-153748752 GGAGAAGGAGAAGCAGCTGCTGG - Intergenic
1035710028 8:1706029-1706051 CGACAAGATGGGGCTCCTGCAGG - Exonic
1036750790 8:11442747-11442769 GGAGAAGATGAGGCACCTGCGGG - Intronic
1037522467 8:19693243-19693265 GGAGAAGAAAAGGCCACTGCTGG - Intronic
1037766543 8:21775739-21775761 GGAGAACAGGAGGGCCCTGCAGG - Intronic
1037954385 8:23042745-23042767 GGAGAAGATGGAGCAACAGCAGG - Intronic
1038439227 8:27560073-27560095 GGTGAAGATGAGGCACAGGGAGG - Intergenic
1039400042 8:37261689-37261711 GGAGAAGATGCGGGAGCAGCTGG - Intergenic
1039800808 8:40952878-40952900 AGAGAAGATGAGTCTTCTGCAGG - Intergenic
1041892227 8:62882186-62882208 GGAGAAGATAAGTCACATTCTGG - Intronic
1041966953 8:63689155-63689177 GGAGAACATGATGCCACTGCTGG + Intergenic
1043691804 8:83163345-83163367 GCAGGAGGTGAGCCACCTGCAGG + Intergenic
1044047556 8:87456333-87456355 GAAAAACATGAGGCACCTGGAGG - Intronic
1044506979 8:93033055-93033077 GGAGAGGATAAAGCACCTGGAGG - Intergenic
1045320025 8:101075377-101075399 GGAGAAGAGGAGGAAACTCCTGG - Intergenic
1046606128 8:116374059-116374081 GAAGGAGATGAGGAACCTGTTGG - Intergenic
1047775774 8:128069088-128069110 GGAGAAGAGGCGGCACCTTAAGG + Intergenic
1049188334 8:141271212-141271234 GGAGAAGATGACCTTCCTGCCGG + Intronic
1049560993 8:143310189-143310211 GGAGAAGAAGAGGCGGCTCCTGG - Exonic
1049740966 8:144240671-144240693 GGAGAAGGTGGGGCACCTGCTGG + Exonic
1049813846 8:144588863-144588885 GGTGAAGATCAGGCACGTCCAGG + Intronic
1049862002 8:144905077-144905099 GGGGAAGATTAGGGTCCTGCGGG + Intergenic
1051169459 9:14304940-14304962 AGAGAAGATGATGCACTGGCAGG + Intronic
1051284585 9:15483230-15483252 GGGGAAGGTGAAGCACCTGTGGG - Intronic
1051723530 9:20064941-20064963 GGAGAAGAGGAGGGACAGGCAGG + Intergenic
1051867150 9:21695682-21695704 GGAGACCATGAAGCAGCTGCAGG + Intergenic
1052089636 9:24312652-24312674 GCAGAGGATGCAGCACCTGCAGG + Intergenic
1054767318 9:69052898-69052920 CGAGAAGCTGAGGCACGTGGTGG + Intronic
1054864223 9:69983491-69983513 GGCCAAGGTGAGGCACCAGCGGG + Intergenic
1056575662 9:87854399-87854421 GGAGGAGATGAGGTGCCTACAGG + Intergenic
1057015281 9:91645520-91645542 GCGGAAGATGGCGCACCTGCTGG + Intronic
1057719111 9:97518082-97518104 GGAGAAGATGGGGCAGGTGTTGG - Intronic
1057951720 9:99374142-99374164 GAAAAAGCCGAGGCACCTGCTGG + Intergenic
1060409499 9:123390737-123390759 GGAGAGGGTGAGGCCCCTGGGGG - Intronic
1060449312 9:123722102-123722124 AAAGGAGATGAGGAACCTGCTGG + Intronic
1060587449 9:124795348-124795370 GGAGAAACCGAGGCACCTGCTGG + Intronic
1060892259 9:127196376-127196398 GGAGCAGATGGTGCAGCTGCAGG - Intronic
1061028696 9:128067008-128067030 GGAGCTGAAGAAGCACCTGCTGG - Exonic
1061181539 9:129027790-129027812 GGAGGGGAGGAGGCACCGGCTGG - Intronic
1061249790 9:129420099-129420121 GGAGAAGCTGAGGCCCAAGCAGG - Intergenic
1061959542 9:133981056-133981078 GGCGAAGATGGGGCACGTGCAGG - Intronic
1062500688 9:136850730-136850752 GGAGAAGAGAAGACGCCTGCTGG - Intronic
1062581742 9:137231925-137231947 GGGGAAGATGGGGCTCCAGCTGG - Intronic
1062736770 9:138141835-138141857 GGAGGAGGTGAGGCACATGGTGG - Intergenic
1188445621 X:30250427-30250449 GCAGGAGATGTGGCACCTGAAGG - Exonic
1190053972 X:47171303-47171325 GGAGAAGTTGAGGGCCCTGGAGG - Intronic
1190841685 X:54151165-54151187 AGAAAAGATCAGGGACCTGCTGG + Intronic
1192165628 X:68826149-68826171 GGAGAACATCTGGCAGCTGCAGG - Intergenic
1196823278 X:119720900-119720922 GGAGAAGATGAGGCCTGAGCTGG + Intergenic
1197183391 X:123561644-123561666 GCAGGAGATCATGCACCTGCAGG + Intergenic
1197400184 X:125980065-125980087 GGTGAAGATGAGGAACTTGTAGG - Intergenic
1199043156 X:143138585-143138607 GGTGGAGATGAGGCACTTGTTGG + Intergenic
1200045311 X:153397757-153397779 GGAGAAGAAGAGGTGGCTGCTGG - Intergenic
1200111149 X:153741560-153741582 TGAGAAGAAGTGGCTCCTGCAGG + Intronic
1200214408 X:154361231-154361253 GGAGAAGATGGGGTACCTTTGGG + Intronic
1200375331 X:155774262-155774284 GGAGAAGCTGAGCAATCTGCAGG + Exonic
1200398993 X:156007909-156007931 GGAGGAGGTGAGGCACATGGTGG - Intronic