ID: 1036750791

View in Genome Browser
Species Human (GRCh38)
Location 8:11442748-11442770
Sequence CGGAGAAGATGAGGCACCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 106, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750791_1036750798 30 Left 1036750791 8:11442748-11442770 CCGCAGGTGCCTCATCTTCTCCG 0: 1
1: 0
2: 3
3: 106
4: 359
Right 1036750798 8:11442801-11442823 TAAAGACGGATATAATAGAATGG No data
1036750791_1036750795 16 Left 1036750791 8:11442748-11442770 CCGCAGGTGCCTCATCTTCTCCG 0: 1
1: 0
2: 3
3: 106
4: 359
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750791 Original CRISPR CGGAGAAGATGAGGCACCTG CGG (reversed) Intronic
900298003 1:1961963-1961985 GGGAGAAGAGGAGGCCCCTCTGG + Intronic
902042650 1:13503910-13503932 TGGAGAAGATGGGACACCAGAGG + Intronic
902074597 1:13773804-13773826 AGGACATGAGGAGGCACCTGGGG + Intronic
902518142 1:17000696-17000718 CGGAGAAACTGAGGGCCCTGGGG - Intronic
903794537 1:25918869-25918891 AGGAGAAGAGGCGGCACCAGAGG + Intergenic
904045817 1:27607535-27607557 CGGAGGTGGTGAGGGACCTGGGG + Intergenic
904330994 1:29757716-29757738 CTGAGCAGATGAGGAAACTGAGG - Intergenic
904488917 1:30846168-30846190 TGGAGAAGGTGAGGAAACTGAGG - Intergenic
904696576 1:32335007-32335029 CGGAACAGATGAGGCAGCCGGGG - Exonic
905174640 1:36127777-36127799 TGGAGAAACTGAGGCACCAGAGG - Intergenic
905655577 1:39684277-39684299 CGGGGGAGGTGAGGCACCCGGGG - Intronic
905695172 1:39968521-39968543 CGGTGAAGATGGGGCACCTGGGG - Intronic
907557093 1:55353401-55353423 CTGAGTAGATGAGGGAGCTGAGG - Intergenic
908441759 1:64162307-64162329 TTGAGAAGAAGAGGCTCCTGTGG + Intronic
913292763 1:117290120-117290142 TGGAGAAGCTGTGGCAGCTGGGG - Intergenic
915162513 1:153930363-153930385 AGGAGGAGCTGAGGCACCGGCGG - Exonic
915195032 1:154182962-154182984 CGGAGATGGTGAGGCTCATGAGG - Intronic
917844189 1:179006649-179006671 CGAAGCAGATGAATCACCTGCGG + Intergenic
920340713 1:205273582-205273604 CGGAGCAGGTGAGCCACCAGCGG + Intergenic
920742964 1:208598715-208598737 GGAAGAATGTGAGGCACCTGGGG - Intergenic
921880924 1:220253355-220253377 AGGAGAAACTGAGGCAACTGGGG + Intronic
924456604 1:244223592-244223614 AGGGGATGATGAGGCACCCGGGG - Intergenic
924902532 1:248416895-248416917 CAAAGAACATGATGCACCTGGGG - Intergenic
1064491312 10:15860293-15860315 CGGACATGATGAGGAACCGGCGG + Exonic
1069426618 10:68294248-68294270 AGGATAAGATGAAGCATCTGTGG - Intronic
1069637486 10:69934526-69934548 CTGGGAAGACGAGGCACCTGAGG + Intronic
1069821831 10:71233265-71233287 CCGAGGAGATGAGGATCCTGAGG + Intronic
1070707580 10:78651819-78651841 CTGAGAAGCTGGGGAACCTGGGG + Intergenic
1071843012 10:89492504-89492526 CGGATCACCTGAGGCACCTGAGG + Intronic
1072682560 10:97517456-97517478 CGTTGAAGATGAGGGAGCTGAGG - Intronic
1074376959 10:112949114-112949136 GGGAGAAGATGGGAAACCTGGGG - Intergenic
1074894270 10:117761332-117761354 AGGAGCAGATGAATCACCTGAGG + Intergenic
1075076789 10:119357370-119357392 AGTGGAAGCTGAGGCACCTGTGG + Intronic
1076296875 10:129392240-129392262 CGGGGAAGGTGAGGCACCATGGG - Intergenic
1076621154 10:131789039-131789061 TGGTGATGATGAGGCAGCTGAGG - Intergenic
1077226650 11:1441615-1441637 AGGAGGGGATGATGCACCTGAGG - Intronic
1077226732 11:1441907-1441929 AGGAGGGGATGATGCACCTGAGG - Intronic
1080873785 11:36259128-36259150 CGACGAAGATGGAGCACCTGCGG - Intergenic
1081789405 11:45772163-45772185 GGGAGAAGAAAAGGCCCCTGGGG - Exonic
1081966825 11:47175212-47175234 GGGAGAAGATCCGGCAGCTGGGG - Exonic
1082236079 11:49821355-49821377 AGGAGGAGATGAGGCAACAGGGG - Intergenic
1082909535 11:58354442-58354464 CAGAGATGATGAGGCCCTTGTGG + Intergenic
1083148509 11:60775715-60775737 AGTAGCAGATGTGGCACCTGCGG + Exonic
1089605791 11:119640487-119640509 CGATGAAGAAGGGGCACCTGGGG + Intronic
1091390851 12:125429-125451 CGGAGAAGAACCCGCACCTGGGG - Intronic
1092878927 12:12872776-12872798 CAGATGAGATGAGGCACCTGGGG + Intergenic
1093228856 12:16518167-16518189 TGGAGAAGATGAGGTAGCAGTGG - Intronic
1094309985 12:29069631-29069653 CTGAATAGATGAGGCACATGTGG + Intergenic
1094828279 12:34288315-34288337 AGGGGAGGTTGAGGCACCTGTGG + Intergenic
1094828418 12:34288905-34288927 AGGGGAGGTTGAGGCACCTGTGG + Intergenic
1094828519 12:34289308-34289330 AGGGGAGGTTGAGGCACCTGTGG + Intergenic
1094833911 12:34313382-34313404 AGGGGAAGTAGAGGCACCTGTGG - Intergenic
1094834162 12:34314458-34314480 AGGAGAGGTAGAGGCACCTGTGG - Intergenic
1094835865 12:34321781-34321803 AGGAGAGGTAGAGGCACCTGTGG - Intergenic
1094837075 12:34327125-34327147 AGGAGACGTAGAGGCACCTGTGG - Intergenic
1094837212 12:34327757-34327779 AGGGGAAGTAGAGGCACCTGTGG - Intergenic
1094843258 12:34350727-34350749 AGGGGAAGTTGAGGCACCCGTGG - Intergenic
1094848481 12:34371898-34371920 AAGGGAAGTTGAGGCACCTGTGG - Intergenic
1094850964 12:34382203-34382225 AAGGGAAGATGAGGCACCTGTGG - Intergenic
1094855008 12:34398970-34398992 AGGAGAGGTTGAGTCACCTGAGG + Intergenic
1094855965 12:34402962-34402984 AGGGCAAGCTGAGGCACCTGTGG + Intergenic
1096094206 12:48924014-48924036 CGGGGGAGTTGAGGCACATGGGG - Intronic
1096654243 12:53078917-53078939 CCCAGAAGAGTAGGCACCTGTGG + Intronic
1096849636 12:54427350-54427372 AGGCGGAGAGGAGGCACCTGAGG - Intergenic
1100033208 12:90218682-90218704 CAGACAAGGTGAGGCACATGTGG - Intergenic
1101716873 12:107319555-107319577 CGGAGAAGGTGAGGCCGCAGCGG - Exonic
1103921231 12:124400283-124400305 CTGAGAACATGAGGACCCTGAGG + Intronic
1104217137 12:126745046-126745068 TGGAGAAGATGAGGAAACTGAGG - Intergenic
1104778337 12:131404285-131404307 TGGAGAAACTGAGGCACATGGGG - Intergenic
1104798048 12:131533365-131533387 GGGAGATGATGTAGCACCTGGGG - Intergenic
1105593180 13:21812598-21812620 CAGGGAAGATGAGGCATCAGGGG + Intergenic
1108174347 13:47777060-47777082 CAGAAAAGATCAGGAACCTGCGG + Intergenic
1110537846 13:76672709-76672731 CTGAGAAGAGGTGGCACCTCGGG + Intergenic
1113471327 13:110548797-110548819 CGGTGCAGATGAGGAAGCTGAGG - Intronic
1114075051 14:19157364-19157386 AGGGGAAGGTGAGGGACCTGGGG + Intergenic
1114075206 14:19158024-19158046 AGGGGAAGGTGATGCACCTGGGG + Intergenic
1114075310 14:19158421-19158443 AGGGAAAGGTGAGGCACCTGGGG + Intergenic
1114075411 14:19158857-19158879 AGGGGAAGGTGAGGCTCCTGGGG + Intergenic
1114086635 14:19240294-19240316 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1114086860 14:19241123-19241145 AGGGGAAGGTGAGGCCCCTGGGG - Intergenic
1114086960 14:19241562-19241584 AGGGAAAGGTGAGGCACCTGGGG - Intergenic
1114087063 14:19241958-19241980 AGGGGAAGGTGATGCACCTGGGG - Intergenic
1114087218 14:19242612-19242634 AGGGGAAGGTGAGGGACCTGGGG - Intergenic
1117661733 14:58013679-58013701 GGGAAAAGATGAGGAAACTGGGG + Intronic
1122048421 14:99039414-99039436 AGGGGAAGAGGAGGCCCCTGGGG + Intergenic
1122349878 14:101082945-101082967 CTGAGAGGATGAGAGACCTGGGG + Intergenic
1122985405 14:105209451-105209473 TGGGGAGGATGAGGCCCCTGGGG + Exonic
1202898225 14_GL000194v1_random:22100-22122 AGGTGAAGGTGAGGCACCTGGGG - Intergenic
1202898278 14_GL000194v1_random:22296-22318 AGGGGAAGGTGAGTCACCTGGGG - Intergenic
1202898386 14_GL000194v1_random:22714-22736 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1202898493 14_GL000194v1_random:23124-23146 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1202898595 14_GL000194v1_random:23515-23537 AAGGGAAGGTGAGGCACCTGGGG - Intergenic
1202898742 14_GL000194v1_random:24115-24137 AGGGGAAGGTGAGGTACCTGTGG - Intergenic
1202899042 14_GL000194v1_random:25343-25365 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1202899341 14_GL000194v1_random:26564-26586 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1202899594 14_GL000194v1_random:27647-27669 AGGGGATGGTGAGGCACCTGGGG - Intergenic
1202899650 14_GL000194v1_random:27839-27861 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1202899744 14_GL000194v1_random:28252-28274 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1123923158 15:25084889-25084911 CAGAGAAGATGAAGCCCATGAGG - Intergenic
1124866489 15:33497135-33497157 GGGAGAAGAGGAGGAATCTGGGG - Intronic
1128083505 15:64870633-64870655 CGCAGAAGCTGAGGGACCTCAGG + Intronic
1129033651 15:72637026-72637048 GGGCGATGATGAGGCACCAGGGG + Intergenic
1129079394 15:73025679-73025701 TGGGGAAGATGAGGCACTTTAGG + Intergenic
1130969346 15:88720030-88720052 GGGAGAAGATGAGGGACTTAGGG - Intergenic
1132576599 16:667144-667166 AGGAGATGATGAGGCAGGTGAGG + Intronic
1132751129 16:1458204-1458226 TGGAGAGGATGAGGCCCCTGGGG - Intronic
1133027389 16:2994769-2994791 GGGAGCAGGTGAGGAACCTGGGG - Intergenic
1134166432 16:11933731-11933753 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1134494281 16:14719998-14720020 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1134499662 16:14759118-14759140 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1134526210 16:14945745-14945767 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1134546198 16:15110628-15110650 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1134580914 16:15369926-15369948 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1134713788 16:16344216-16344238 AGGAGAAGGTGAGAAACCTGAGG - Intergenic
1134721658 16:16387570-16387592 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1134945768 16:18324305-18324327 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1134953029 16:18364441-18364463 AGGAGAAGGTGAGAAACCTGAGG + Intergenic
1135140223 16:19914958-19914980 GGGAGAAGATGAGGAACCAGGGG - Intergenic
1135311823 16:21411148-21411170 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1135447068 16:22527737-22527759 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1136030547 16:27499596-27499618 CGGAGAAAATGAGCCAAGTGTGG - Intronic
1136150992 16:28349048-28349070 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1136167226 16:28462888-28462910 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1136195751 16:28652128-28652150 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1136212089 16:28766253-28766275 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1136256808 16:29046181-29046203 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1136308527 16:29390155-29390177 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1136321942 16:29491681-29491703 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1136436623 16:30231654-30231676 AGGAGAAGGTGAGAAACCTGAGG + Intronic
1138595993 16:58029172-58029194 CTGAGTAGATGAGGCAGCGGGGG + Intronic
1139856228 16:69982564-69982586 AGGAGAAGGTGAGAAACCTGAGG + Intergenic
1140366500 16:74385513-74385535 AGGAGAAGGTGAGAAACCTGAGG - Intronic
1141376662 16:83536949-83536971 CTGAGAAGATGAAACACCTGTGG - Intronic
1144227377 17:13162710-13162732 CTTAGAAGATGAGAAACCTGAGG + Intergenic
1144230730 17:13200570-13200592 TGGTGAAGAGGAGGCTCCTGGGG + Intergenic
1144240680 17:13308021-13308043 CTGAGAGGATGTGGCATCTGTGG + Intergenic
1144466938 17:15504495-15504517 CGCGGAAGATGAGGCAGCTTTGG + Intronic
1144468664 17:15517486-15517508 TGGATAAGATGAGGAAACTGAGG - Intronic
1146570474 17:33948345-33948367 CTGACAAAATGAGGCTCCTGCGG - Intronic
1148073908 17:44924515-44924537 CGGAGAAGAGGAGGCCCTTTAGG + Intergenic
1148871056 17:50658992-50659014 GGGAGGAGATGGGACACCTGGGG + Intronic
1148894224 17:50830820-50830842 CCCAGAAGAGGAGGCACCTCTGG - Intergenic
1149814828 17:59713498-59713520 TGGACCAGATGAGTCACCTGGGG + Intronic
1151560970 17:74869346-74869368 CAGGGAAGAGGAGGCAGCTGTGG + Intronic
1152130198 17:78471915-78471937 CGGAGGAGATGAGATACCTGGGG - Intronic
1152228176 17:79102247-79102269 TGGAGAAGACGAGGCATGTGTGG + Intronic
1152879783 17:82808401-82808423 TGGAGAGGATGAGGCAGGTGCGG + Intronic
1203162509 17_GL000205v2_random:64172-64194 GAGGGGAGATGAGGCACCTGTGG - Intergenic
1154117700 18:11625790-11625812 AGGAGAAGGTGAGAAACCTGAGG + Intergenic
1155563515 18:27107087-27107109 CAGAGAAGGTGAGGGCCCTGGGG + Intronic
1156498022 18:37538614-37538636 CAGAGCAGAGGAGGCACCTGAGG - Intronic
1159255527 18:65939833-65939855 TGGAGAAGATGGGGGCCCTGAGG + Intergenic
1160531588 18:79568137-79568159 CGGAGAAGTGGAGGGAGCTGGGG - Intergenic
1161034907 19:2079199-2079221 CGGGGAAGATGCGGCCCCTGCGG - Intronic
1161169903 19:2807451-2807473 CGCAGAAGCTGAAGCCCCTGGGG + Exonic
1161766460 19:6211487-6211509 GGGACAAGATGAGGGACCTCAGG + Intergenic
1163248645 19:16112512-16112534 CTGACAAGATGAGGAATCTGAGG + Intronic
1163270110 19:16247946-16247968 TGGTGAAGATGAGGAAACTGAGG + Intergenic
1163530103 19:17843817-17843839 CGGAGAAGATGTGGCTCGGGGGG + Exonic
1164052095 19:21592433-21592455 AGCAGTAGATGAGGCTCCTGAGG + Intergenic
1164779469 19:30880839-30880861 CCGAGCAGATGAGGGCCCTGGGG + Intergenic
1165945237 19:39437815-39437837 CAGAGAAACTGAGGCAACTGTGG - Intronic
1167285950 19:48599111-48599133 TGGAGAAGAGGGGGCACCAGGGG - Intronic
1167608269 19:50493261-50493283 GGGAGCAGATGAGGAAACTGAGG - Intergenic
1167908632 19:52683478-52683500 GGGAGAAGGTCAGGGACCTGAGG - Intronic
1167939778 19:52937357-52937379 GGGAGAAGGTCAGGGACCTGAGG - Intronic
1167944687 19:52978690-52978712 GGGAGAAGGTCAGGGACCTGAGG - Intergenic
1167988525 19:53338478-53338500 GGGAGAAGGTCAGGGACCTGAGG + Intronic
1168291400 19:55359401-55359423 GGGAGAAGCTGACGCAGCTGAGG + Exonic
1168322196 19:55517299-55517321 CGGAGAGGCGGAGGGACCTGGGG - Exonic
1202647707 1_KI270706v1_random:157374-157396 AGGGGAAGGTGAGACACCTGGGG + Intergenic
1202647806 1_KI270706v1_random:157788-157810 AGGGGAAGGTGAGGCACCTGAGG + Intergenic
1202647863 1_KI270706v1_random:157982-158004 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1202648114 1_KI270706v1_random:159111-159133 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1202648397 1_KI270706v1_random:160321-160343 AGGGGAAGGTGAGGCACATGGGG + Intergenic
925824316 2:7832558-7832580 CTAAGAAGAGGGGGCACCTGGGG - Intergenic
925902249 2:8516961-8516983 CGTAGACGGTGATGCACCTGGGG + Intergenic
925934093 2:8736440-8736462 TGGAGAAAATGAGGCAAGTGTGG + Intronic
926003472 2:9353122-9353144 CTGAGAAGGTGAGGGACATGGGG + Intronic
926018903 2:9477260-9477282 CAGAGAAGCTGGGGCACCCGCGG - Intronic
926149760 2:10418813-10418835 AGGGAAAAATGAGGCACCTGTGG - Intronic
927490910 2:23520325-23520347 GGGTGCAGATCAGGCACCTGAGG - Intronic
927885500 2:26715788-26715810 TGGAGAGGGTGAGGGACCTGGGG - Intronic
928291083 2:30037892-30037914 GGAAGAAATTGAGGCACCTGGGG - Intergenic
931628287 2:64276654-64276676 CAGAGCAGATGAGGAATCTGTGG - Intergenic
932323121 2:70836418-70836440 CGGGGTTGAAGAGGCACCTGGGG + Intergenic
932432233 2:71682968-71682990 AGGAGAAGATGAGGCCCTTTGGG + Intronic
933408104 2:81888699-81888721 AGCAGAAGATGAGGCTACTGAGG - Intergenic
933595711 2:84281261-84281283 CAGAGAAGTTGAGGCAGCTTTGG - Intergenic
933646421 2:84816489-84816511 CGAAGCAGATGAATCACCTGAGG + Intronic
933774504 2:85764101-85764123 CGGAGAAGCTGAGGTTGCTGTGG - Exonic
934614695 2:95763891-95763913 AGGGGAAGAGGAGGCAGCTGTGG + Intergenic
934839612 2:97616687-97616709 AGGGGAAGAGGAGGCAGCTGTGG - Intergenic
935815574 2:106843441-106843463 GGGTGAAGAAGAGGCACCGGAGG - Exonic
937127416 2:119483294-119483316 CGGCGGAGATGAGGAAGCTGAGG + Intronic
937147043 2:119656412-119656434 TCGAGGAGATGAGGAACCTGCGG + Exonic
937998179 2:127710919-127710941 CGGAGAAGATAAAGCACGTGTGG - Intronic
938293001 2:130160227-130160249 CAGAGGAGAGGAGGGACCTGAGG - Intronic
938463555 2:131512738-131512760 CAGAGGAGAGGAGGAACCTGAGG + Intergenic
938489375 2:131753907-131753929 AGGGGAAGGTGAGGCACCTGGGG + Intronic
938489429 2:131754100-131754122 AGGGGAAGGTGAGGCACCTGGGG + Intronic
938489532 2:131754512-131754534 AGGGGAAGGTGAGGCACCTGAGG + Intronic
938489589 2:131754704-131754726 AGAGGAAGGTGAGGCACCTGGGG + Intronic
938489864 2:131755743-131755765 AGGGGAAGGGGAGGCACCTGGGG + Intronic
938489911 2:131755967-131755989 AGGGGAAGGTGAGGCACTTGTGG + Intronic
938490005 2:131756376-131756398 AGGGGAAGGTGAGGCACCTGGGG + Intronic
946647312 2:221851689-221851711 AGGAGATGGTGAGGCATCTGTGG - Intergenic
946762285 2:223006389-223006411 ATGAGGAGATGAGGGACCTGAGG + Intergenic
947162249 2:227226336-227226358 GGGAGAAGGGGAGGCACATGGGG + Intronic
948311702 2:236992062-236992084 GGGAGAAGCTGAGGCCACTGGGG - Intergenic
948499646 2:238382553-238382575 CGGGGAGGATGAGGGACATGTGG + Intronic
1170568929 20:17622087-17622109 AGGAGAAGATGAGGCTCCATGGG + Intronic
1172037046 20:32018269-32018291 TGGAGAAGGAGAGGGACCTGCGG + Intronic
1175379370 20:58552269-58552291 CTGAGCAGATGAGGAAACTGAGG + Intergenic
1175417920 20:58813682-58813704 CAGAGAAGGTGAGTCCCCTGTGG - Intergenic
1175464757 20:59183091-59183113 CTGGGAAGTTGGGGCACCTGAGG + Intergenic
1176603455 21:8812368-8812390 AGGGGAAGGTGAGGCACATGGGG - Intergenic
1176603736 21:8813584-8813606 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1176603988 21:8814747-8814769 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1176604043 21:8814938-8814960 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1176604145 21:8815357-8815379 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1176617855 21:9037896-9037918 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1176617965 21:9038289-9038311 AGGGGAAGGTGAGTCACCTGGGG - Intergenic
1176618070 21:9038705-9038727 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1176618175 21:9039114-9039136 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1176618278 21:9039505-9039527 AAGGGAAGGTGAGGCACCTGGGG - Intergenic
1176618427 21:9040108-9040130 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1176618722 21:9041327-9041349 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1176618970 21:9042421-9042443 AGGGGATGGTGAGGCACCTGGGG - Intergenic
1176619026 21:9042613-9042635 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1176619119 21:9043026-9043048 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1176706022 21:10120401-10120423 GGGGGAAGTTGAGGCACCTGGGG + Intergenic
1176706145 21:10121002-10121024 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1176706371 21:10122126-10122148 AGGTGAAGGTGATGCACCTGGGG + Intergenic
1176706468 21:10122524-10122546 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1176706564 21:10122954-10122976 AGGGGAAGGTGAGACACCTGGGG + Intergenic
1176706665 21:10123345-10123367 AGGGGAAGGTGAGGCACCTGCGG + Intergenic
1176706752 21:10123749-10123771 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1176706914 21:10124380-10124402 AGGGGAAGGTGAGGTACCTGGGG + Intergenic
1176707021 21:10124790-10124812 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1176707079 21:10124988-10125010 AGGGGAAGGTGAGGCACCTGTGG + Intergenic
1176707127 21:10125184-10125206 AGGGGTAGGTGAGGCACCTGAGG + Intergenic
1176707233 21:10125598-10125620 AGGGGAAGGTGAGTCACCTGGGG + Intergenic
1176707288 21:10125793-10125815 AGGGAAAGGTGAGGCACCTGGGG + Intergenic
1176994698 21:15541931-15541953 TTGAGAAGTTGAGGCAACTGAGG + Intergenic
1178019389 21:28392305-28392327 CTGGGATGATGAGGCATCTGTGG - Intergenic
1180290699 22:10850279-10850301 AGGGGAAGGTGAGGGACCTGGGG + Intergenic
1180290855 22:10850929-10850951 AGGGGAAGGTGACGCACCTGGGG + Intergenic
1180290955 22:10851326-10851348 AGGGAAAGGTGAGGCACCTGGGG + Intergenic
1180291230 22:10852444-10852466 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1180345738 22:11703926-11703948 AGGGGAAGGTGAGGCACATGGGG - Intergenic
1180346019 22:11705135-11705157 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1180346272 22:11706324-11706346 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1180346327 22:11706516-11706538 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1180346429 22:11706935-11706957 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1180353505 22:11822170-11822192 AGAGGAAGGTGAGGCACCTGGGG - Intergenic
1180353791 22:11823391-11823413 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1180354043 22:11824481-11824503 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1180354103 22:11824674-11824696 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1180354198 22:11825088-11825110 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1180384142 22:12167652-12167674 AGGGGAAGGTGAGGCACCTGAGG + Intergenic
1180384202 22:12167844-12167866 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1180384454 22:12168968-12168990 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1180384736 22:12170186-12170208 AGAGGAAGGTGAGGCACCTGGGG + Intergenic
1180493500 22:15879700-15879722 AGGGGAAGGTGAGGGACCTGGGG + Intergenic
1180493656 22:15880355-15880377 AGGGGAAGGTGACGCACCTGGGG + Intergenic
1180493757 22:15880752-15880774 AGGGAAAGGTGAGGCACCTGGGG + Intergenic
1180494034 22:15881866-15881888 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1181918332 22:26298871-26298893 GAGAGAAGATGAGGCCCCTGGGG - Intronic
1183863458 22:40685476-40685498 GGGAGAAGATAAGGCAGCAGTGG - Intergenic
1185314976 22:50175054-50175076 TGGAGCAGATGAGGAAACTGAGG + Intronic
1185344637 22:50305933-50305955 GGGAGAAGATGCGTCACCTTTGG - Intronic
951711854 3:25591475-25591497 GAGAGAAAATGAGGCAGCTGTGG + Intronic
955983717 3:64551897-64551919 TGGAGAAGAAAAGGCACCTGGGG - Intronic
956090680 3:65663483-65663505 CGGAGAAGAGGAGTCAAATGTGG + Intronic
959667915 3:108942302-108942324 TGGAGAAGTTGAGGCATTTGGGG - Intronic
960438368 3:117655668-117655690 CAGAGAGGATGAGGCAGATGAGG + Intergenic
965610533 3:170538944-170538966 CAGAGAAGAGGAGGCTCCAGTGG - Intronic
965822092 3:172694678-172694700 CTGAGAAGCCGAGGAACCTGAGG - Intronic
966920721 3:184609861-184609883 TGGAGAAACTGAGGCACCAGTGG - Intronic
968613347 4:1566887-1566909 TGGAGAAGAAGAGAGACCTGGGG - Intergenic
969267135 4:6071826-6071848 CGGGGAAGATGTGGGTCCTGGGG - Intronic
969330552 4:6471697-6471719 TGGAGAAGAAGAGGGACCCGGGG - Intronic
969517905 4:7658747-7658769 TGGAGAAGGTGAGGCAAATGGGG + Intronic
970785623 4:19792948-19792970 CTTAGAAGAAGAGCCACCTGTGG + Intergenic
973373972 4:49275563-49275585 AGGGGAAGGTGAGACACCTGGGG + Intergenic
973374072 4:49275978-49276000 AGGGGAAGGTGAGGCACCTGAGG + Intergenic
973374128 4:49276171-49276193 AGGGGAAGGTGAGGCACCTAGGG + Intergenic
973374386 4:49277260-49277282 AGGGGAAGGTGAGGCACCAGGGG + Intergenic
973374626 4:49278281-49278303 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
973382785 4:49331960-49331982 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
973383025 4:49332981-49333003 AGGGGAAGGTGAGGCACCAGGGG - Intergenic
973383284 4:49334068-49334090 AGGGGAAGGTGAGGCACCTAGGG - Intergenic
973383340 4:49334261-49334283 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
973383440 4:49334676-49334698 AGGGGAAGGTGAGACACCTGGGG - Intergenic
973386404 4:49517004-49517026 AGGGGAAGGTGAGGTACCTGGGG - Intergenic
973386646 4:49518024-49518046 AGGGGAAGGTGAGGCACCAGGGG - Intergenic
973386892 4:49519083-49519105 AGGGGAAGGTGAGGCACCTAGGG - Intergenic
973386947 4:49519275-49519297 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
973387047 4:49519690-49519712 AGGGGAAGGTGAGACACCTGGGG - Intergenic
979154824 4:117371371-117371393 CGGAGAAGGTGCAGAACCTGAGG - Intergenic
981454370 4:144936610-144936632 CGAAGCAGATGGGTCACCTGAGG - Intergenic
983690632 4:170465132-170465154 TGGAGCTGATGTGGCACCTGTGG + Intergenic
983873615 4:172850922-172850944 CTTAGAAGATGGTGCACCTGAGG - Intronic
984252203 4:177348305-177348327 GGGGGAACCTGAGGCACCTGAGG - Intronic
985531601 5:436833-436855 CTGTGAAGACCAGGCACCTGAGG + Exonic
986802827 5:11279431-11279453 CAGAGATGATGGGGCACCAGAGG - Intronic
987780543 5:22428683-22428705 CGGAGCAGATGAAGAAACTGAGG + Intronic
989805103 5:45594140-45594162 CTGAGAGGCTGAGGCACTTGGGG - Intronic
992940764 5:81759029-81759051 CGGAGGAAATGATGGACCTGAGG - Intergenic
993218588 5:85059650-85059672 CCGAGAAGATGGATCACCTGAGG - Intergenic
997528473 5:134568228-134568250 CTGAGCAGATGAGGAAACTGGGG + Intronic
997675327 5:135708424-135708446 GGGAGAAGACAAAGCACCTGAGG - Intergenic
998376598 5:141694941-141694963 AGGAGAAACTGAGGCAGCTGAGG + Intergenic
999209426 5:149874950-149874972 CTGAGCAGATGAGGAAACTGAGG + Intronic
999630927 5:153570667-153570689 TGGAGAAGATAAGGCGCCAGAGG - Intronic
1000629012 5:163570703-163570725 TGGAGAAACTGAGGCACATGGGG + Intergenic
1000856154 5:166400800-166400822 ATGAGAAGAAGAGTCACCTGAGG - Intergenic
1002132015 5:177087431-177087453 CGGCAGAGATGAGGGACCTGAGG + Intronic
1002535876 5:179875105-179875127 CGGAGAAGATGCAGGACCTGGGG - Exonic
1002782555 6:378821-378843 GGGAGAAGCGAAGGCACCTGAGG + Intergenic
1003220861 6:4159977-4159999 TGCAGAAGATGAGGCCTCTGAGG - Intergenic
1005055836 6:21728123-21728145 AGGGGACTATGAGGCACCTGGGG - Intergenic
1006844658 6:37053944-37053966 GGTAGAAGATGTGGCACCTCAGG + Intergenic
1007238827 6:40410740-40410762 GGCAGAAGATGAGCCGCCTGAGG + Intronic
1007635575 6:43297969-43297991 CTAAGAAGAGGAGGCCCCTGGGG - Intronic
1008064415 6:47032126-47032148 GGGAGAGGTTGTGGCACCTGTGG + Intronic
1011629347 6:89309366-89309388 GGGAGAAGCTGAGGAAGCTGTGG - Intronic
1013464903 6:110409410-110409432 CAGAGGAGATGAGGGAACTGAGG + Intronic
1016376817 6:143429949-143429971 CAGTGAAGATGAGGCCACTGAGG - Intronic
1017340597 6:153317263-153317285 GGCAGAAGTTGAGGCACCTGTGG - Intergenic
1017521573 6:155207542-155207564 CTGAGAAGAGAAGGCAGCTGTGG - Intronic
1018492002 6:164303451-164303473 CCGGGAAGAGGAGGCAACTGTGG - Intergenic
1021164332 7:17316927-17316949 CTGAGAAGATGAAGACCCTGTGG - Intronic
1021416809 7:20395870-20395892 CGCAGAGGAGGAAGCACCTGAGG - Intronic
1021463987 7:20921138-20921160 GGGAGAAGCTGAGGCAGCTCAGG - Intergenic
1024343153 7:48287216-48287238 CAGAGAGGTGGAGGCACCTGAGG + Intronic
1026679486 7:72454761-72454783 CGGAGAGGAGGAGACAGCTGAGG - Intergenic
1026931254 7:74224121-74224143 GGAAGAAGATGAGGAATCTGAGG + Exonic
1027907260 7:84200914-84200936 AGGAAAAAATGAGGCATCTGTGG + Intronic
1029298747 7:99561899-99561921 CGGGGAAGAGCAGGCACCTGAGG - Intronic
1031252729 7:119408735-119408757 AGGAGAAAAGGAGGCCCCTGTGG + Intergenic
1032324096 7:130910318-130910340 AGGAAAAGATAAGGCAACTGAGG - Intergenic
1033257372 7:139813888-139813910 TGGAGAGGAAGTGGCACCTGAGG - Intronic
1036201205 8:6773007-6773029 CGGACAAGATCAGACACCCGAGG + Intergenic
1036647428 8:10620371-10620393 CGAGGCAGATGAGTCACCTGAGG + Intronic
1036750791 8:11442748-11442770 CGGAGAAGATGAGGCACCTGCGG - Intronic
1037832255 8:22196576-22196598 AGGAGAAGATGGGGAGCCTGTGG - Intronic
1038323201 8:26548262-26548284 CAGGCAAGATGAGGCACCTATGG + Intronic
1043539510 8:81243702-81243724 GTGAGAAGACGAGGCAGCTGGGG + Intergenic
1044800145 8:95945444-95945466 GGGAGAAGATGACGCTCCTCGGG + Intergenic
1049793470 8:144484320-144484342 CGGAGTAGATGTGGCAACTAAGG - Intronic
1051284586 9:15483231-15483253 AGGGGAAGGTGAAGCACCTGTGG - Intronic
1051952330 9:22651218-22651240 GGGAGAAGATGAGGTACTTTTGG + Intergenic
1053212897 9:36246394-36246416 GGGAGAAGATGAGGCAGCCATGG - Exonic
1053643296 9:40107518-40107540 GGGGGAAGTTGAGGCACCTGGGG + Intergenic
1053643424 9:40108119-40108141 AGGGGAAGGCGAGGCACCTGGGG + Intergenic
1053643661 9:40109245-40109267 AGGGGAAGGTGATGCACCTGGGG + Intergenic
1053643760 9:40109647-40109669 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1053643856 9:40110072-40110094 AGGGGAAGGTGAGACACCTGGGG + Intergenic
1053643961 9:40110465-40110487 AGGGGAAGGTGAGGCACCTGCGG + Intergenic
1053644002 9:40110682-40110704 CAGGAGAGATGAGGCACCTGTGG + Intergenic
1053644051 9:40110888-40110910 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1053644213 9:40111533-40111555 AGGGGAAGGTGAGGTACCTGGGG + Intergenic
1053644323 9:40111945-40111967 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1053644381 9:40112143-40112165 AGGGGAAGGTGAGGCACCTGTGG + Intergenic
1053644430 9:40112339-40112361 AGGGGTAGGTGAGGCACCTGAGG + Intergenic
1053761504 9:41352342-41352364 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1053761619 9:41352736-41352758 AGGGGAAGGTGAGTCACCTGGGG - Intergenic
1053761731 9:41353149-41353171 AGGGGTAGGTGAGGCACCTGAGG - Intergenic
1053761777 9:41353344-41353366 AGGGGAAGGTGAGGCACCTGTGG - Intergenic
1053761834 9:41353542-41353564 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1053761946 9:41353952-41353974 AGGGGAAGGTGAGGTACCTGGGG - Intergenic
1053762103 9:41354592-41354614 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1053762151 9:41354807-41354829 CAGGAGAGATGAGGCACCTGTGG - Intergenic
1053762191 9:41355024-41355046 AGGGGAAGGTGAGGCATCTGCGG - Intergenic
1053762296 9:41355417-41355439 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1053762394 9:41355843-41355865 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1053762492 9:41356246-41356268 AGGGGAAGGTGATGCACCTGGGG - Intergenic
1053762726 9:41357370-41357392 AGGGGAAGGCGAGGCACCTGGGG - Intergenic
1053762771 9:41357565-41357587 AGCGGAAGGTGAGGCACCTGAGG - Intergenic
1053762856 9:41357972-41357994 GGGGGAAGTTGAGGCACCTGGGG - Intergenic
1054324154 9:63704747-63704769 GGGGGAAGTTGAGGCACCTGGGG + Intergenic
1054324233 9:63705152-63705174 AGCGGAAGGTGAGGCACCTGAGG + Intergenic
1054324279 9:63705347-63705369 AGGGGAAGGCGAGGCACCTGGGG + Intergenic
1054324517 9:63706470-63706492 AGGGGAAGGTGATGCACCTGGGG + Intergenic
1054324613 9:63706878-63706900 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1054324711 9:63707300-63707322 AGGGGAAGGTGAGACACCTGGGG + Intergenic
1054324816 9:63707694-63707716 AGGGGAAGGTGAGGCACCTGCGG + Intergenic
1054324905 9:63708117-63708139 AGGGGAAGGTGAAGCACCTGGGG + Intergenic
1054325065 9:63708768-63708790 AGGGGAAGGTGAGGTACCTGGGG + Intergenic
1054325172 9:63709188-63709210 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1054325230 9:63709386-63709408 AGGGGAAGGTGAGGCACCTGTGG + Intergenic
1054325277 9:63709586-63709608 AGGGGTAGGTGAGGCACCTGAGG + Intergenic
1054325390 9:63710000-63710022 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1054325501 9:63710390-63710412 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1054350273 9:64013886-64013908 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1054350389 9:64014273-64014295 AGGAGAAGGTGAGGCACCTGGGG - Intergenic
1054350488 9:64014663-64014685 AAGGGAAGGTGAGGCACCTGGGG - Intergenic
1054350639 9:64015261-64015283 AGGGGAAGGTGAGGCACCTGTGG - Intergenic
1054350802 9:64015901-64015923 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1054350860 9:64016093-64016115 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1054350954 9:64016507-64016529 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1054540098 9:66263459-66263481 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1054540323 9:66264268-66264290 AGGGGTAGGTGAGGCACCTGAGG - Intergenic
1054540371 9:66264464-66264486 ACGGGAAGGTGAGGCACCTGTGG - Intergenic
1054540428 9:66264662-66264684 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1054540538 9:66265075-66265097 AGGGGAAGGTGAGGTACCTGGGG - Intergenic
1054540697 9:66265712-66265734 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1054540747 9:66265927-66265949 CAGGAGAGATGAGGCACCTGTGG - Intergenic
1054540788 9:66266144-66266166 AGGGGAAGGTGAGGCACCTGCGG - Intergenic
1054540890 9:66266536-66266558 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1054540990 9:66266960-66266982 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1054541090 9:66267360-66267382 AGGGGAAGGTGATGCACCTGGGG - Intergenic
1054541328 9:66268484-66268506 AGGGGAAGGCGAGGCACCTGGGG - Intergenic
1054541373 9:66268679-66268701 AGCGGAAGGTGAGGCACCTGAGG - Intergenic
1054541459 9:66269085-66269107 GGGGGAAGTTGAGGCACCTGGGG - Intergenic
1054713538 9:68535452-68535474 TGGAGAAGATGAGGCCACAGAGG + Intergenic
1054925837 9:70587953-70587975 AGCAGAAGATAAGGAACCTGGGG - Intronic
1056934246 9:90903674-90903696 CAGAGAATATGGGGCTCCTGAGG + Intergenic
1059426235 9:114222500-114222522 CAGAGAAGGTGATCCACCTGAGG - Intronic
1060237965 9:121879376-121879398 CTGAGAAAATGAGGCACACGTGG - Intronic
1060297607 9:122353845-122353867 AGGAGAAGAGGAGGCAGGTGAGG - Intergenic
1060409500 9:123390738-123390760 AGGAGAGGGTGAGGCCCCTGGGG - Intronic
1060969013 9:127727411-127727433 GGGAGAGGCTGAGGCCCCTGAGG + Exonic
1061779983 9:132989715-132989737 CGGAGGAAATGAGGCCCCGGGGG - Intronic
1202791055 9_KI270719v1_random:90489-90511 GGGGGAAGTTGAGGCACCTGGGG + Intergenic
1202791179 9_KI270719v1_random:91090-91112 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1202791409 9_KI270719v1_random:92215-92237 AGGTGAAGGTGATGCACCTGGGG + Intergenic
1202791506 9_KI270719v1_random:92613-92635 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1202791659 9_KI270719v1_random:93253-93275 AGGGGAAGGTGAGGTACCTGGGG + Intergenic
1202791766 9_KI270719v1_random:93663-93685 AGGGGAAGGTGAGGCACCTGGGG + Intergenic
1202791824 9_KI270719v1_random:93861-93883 AGGGGAAGGTGAGGCACCTGTGG + Intergenic
1202791873 9_KI270719v1_random:94058-94080 AGGGGTAGGTGAGGCACCTGAGG + Intergenic
1202791981 9_KI270719v1_random:94473-94495 AGGGGAAGGTGAGTCACCTGGGG + Intergenic
1202792035 9_KI270719v1_random:94672-94694 AGGGAAAGGTGAGGCACCTGGGG + Intergenic
1203697653 Un_GL000214v1:113475-113497 AGGGGAAGGTGAGACACCTGGGG + Intergenic
1203697749 Un_GL000214v1:113888-113910 AGGGGAAGGTGAGGCACCTGAGG + Intergenic
1203697803 Un_GL000214v1:114080-114102 AGGAGAAGGTGAGGCACCTGGGG + Intergenic
1203698053 Un_GL000214v1:115168-115190 AGGGGAAGGTGAGGCACCCGGGG + Intergenic
1203550911 Un_KI270743v1:164791-164813 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1203551151 Un_KI270743v1:165813-165835 AGGGGAAGGTGAGGCACCAGGGG - Intergenic
1203551400 Un_KI270743v1:166903-166925 AGGGGAAGGTGAGGCACCTAGGG - Intergenic
1203551455 Un_KI270743v1:167096-167118 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1203551552 Un_KI270743v1:167512-167534 AGGGGAAGGTGAGACACCTGGGG - Intergenic
1185807320 X:3070486-3070508 CGGAGACGATAAGACTCCTGAGG - Intronic
1189329719 X:40136196-40136218 CGTAGAAGATGAGGGACACGTGG + Intronic
1190298002 X:49039862-49039884 AGGGGAAGAAGAGGAACCTGGGG - Intronic
1191696183 X:63993255-63993277 TGGAGAAGAGGAGGGAGCTGTGG - Intergenic
1198026514 X:132712790-132712812 CGGAGCAGATGGATCACCTGAGG + Intronic
1198510022 X:137341089-137341111 GGGAGAGGGTGAGGCAACTGAGG + Intergenic
1200214407 X:154361230-154361252 TGGAGAAGATGGGGTACCTTTGG + Intronic
1200699693 Y:6391607-6391629 AGGAAAAGATGAGGCAAGTGTGG + Intergenic
1200701764 Y:6408570-6408592 AGGAAAAGATGAGGCAATTGTGG + Intergenic
1201032347 Y:9756128-9756150 AGGAAAAGATGAGGCAATTGTGG - Intergenic
1201034418 Y:9773091-9773113 AGGAAAAGATGAGGCAAGTGTGG - Intergenic
1201151235 Y:11096735-11096757 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1201151292 Y:11096929-11096951 AGGTGAAGGTGAGGCACCTGGGG - Intergenic
1201151344 Y:11097124-11097146 AGGGGAAGGTGAGTCACCTGGGG - Intergenic
1201151453 Y:11097541-11097563 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1201151564 Y:11097951-11097973 AGGGGAAGGTAAGGCACCTGGGG - Intergenic
1201151664 Y:11098349-11098371 AAGGGAAGGTGAGGCACCTGGGG - Intergenic
1201151812 Y:11098942-11098964 AGGGGAAGGTGAGGCACCTGTGG - Intergenic
1201151970 Y:11099556-11099578 AGGGGAAGGTGAGGTACCTGGGG - Intergenic
1201152130 Y:11100194-11100216 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1201152422 Y:11101416-11101438 AGGGGAAGGTGAGGCACCTGGGG - Intergenic
1201152673 Y:11102506-11102528 AGGGGATGGTGAGGCACCTGGGG - Intergenic
1201152731 Y:11102698-11102720 AGGGGAAGGTGAGGCACCTGAGG - Intergenic
1201152826 Y:11103118-11103140 AGGGGAAGGTGAGACACCTGGGG - Intergenic