ID: 1036750792

View in Genome Browser
Species Human (GRCh38)
Location 8:11442757-11442779
Sequence TGTCGGCTTCGGAGAAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750792_1036750795 7 Left 1036750792 8:11442757-11442779 CCTCATCTTCTCCGAAGCCGACA 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data
1036750792_1036750798 21 Left 1036750792 8:11442757-11442779 CCTCATCTTCTCCGAAGCCGACA 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1036750798 8:11442801-11442823 TAAAGACGGATATAATAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750792 Original CRISPR TGTCGGCTTCGGAGAAGATG AGG (reversed) Intronic
906431197 1:45757020-45757042 GGTCTGCGTGGGAGAAGATGGGG + Intergenic
906740726 1:48181318-48181340 TTTTGGCTAGGGAGAAGATGAGG - Intergenic
913229965 1:116733637-116733659 TGTGGGCTGGGGACAAGATGTGG - Intergenic
916446586 1:164877893-164877915 GGTTGGCTGGGGAGAAGATGAGG - Intronic
916483429 1:165235820-165235842 TGACGGCTTTGGAGATTATGGGG + Intronic
917869809 1:179230845-179230867 TGTAGGGTTGGGAGAAGAGGTGG + Intergenic
923622795 1:235591722-235591744 TCTCGGCTTTCCAGAAGATGAGG + Intronic
1062904744 10:1172290-1172312 TGTCGCCTTATGAGAAGCTGAGG - Intergenic
1065852941 10:29805856-29805878 TGAGGGCCTCGGAGAAGATATGG - Intergenic
1070283452 10:75067071-75067093 TGTCTGCTTGGGAGAGGCTGAGG - Intergenic
1077154444 11:1085138-1085160 TGTCGGCCTCGGAGAGGGAGCGG - Intergenic
1077703031 11:4459172-4459194 AGTCTGCATGGGAGAAGATGGGG - Intergenic
1083611905 11:64008355-64008377 TGGCGGCTTCTGAGCAGGTGAGG + Intronic
1084047215 11:66576102-66576124 TGTAGGCTTCCGAGGAGATCGGG - Intergenic
1085996877 11:81928194-81928216 TCTTGGCGTGGGAGAAGATGTGG - Intergenic
1086922843 11:92606817-92606839 TATAGGCTTTGGAGCAGATGAGG + Intronic
1100328181 12:93561066-93561088 TGTCAGATTCGAAGAAGATCAGG - Intergenic
1108521459 13:51250621-51250643 TGTGGGCTTCTGAGTGGATGTGG + Intronic
1108705349 13:52980499-52980521 GGTCAGCTTTTGAGAAGATGAGG + Intergenic
1113794069 13:113046609-113046631 TGTGGGCATCGGAGCAGATATGG - Intronic
1113795600 13:113055973-113055995 TGTCTGCTGCGGAGTGGATGAGG - Intronic
1114532644 14:23405247-23405269 TGTCGGAGATGGAGAAGATGTGG + Exonic
1114537576 14:23432663-23432685 TGTCGGAGATGGAGAAGATGTGG + Exonic
1114639618 14:24210659-24210681 TATGGGCTTTGGAGATGATGTGG - Exonic
1119218870 14:72890919-72890941 TGTCAGCTTCAGAGAGGAAGGGG + Intronic
1121482291 14:94288515-94288537 TGTCGACTTCGGTGAAGACAGGG + Exonic
1122341280 14:101030163-101030185 TGGCAACTTCGGAGAAGATGTGG + Intergenic
1124072124 15:26405215-26405237 TAACGGCTTAGGATAAGATGGGG + Intergenic
1129656056 15:77526511-77526533 TGCTGGGTTCTGAGAAGATGGGG - Intergenic
1131447798 15:92513995-92514017 TGTAGGCTTCCGAGGAGATCCGG - Intergenic
1132045747 15:98561643-98561665 TGTAGGCTTCTTTGAAGATGTGG - Intergenic
1132689719 16:1177047-1177069 TGTAGGGTTCAGAGAAGGTGCGG - Intronic
1133818661 16:9217076-9217098 TGTCTTCTTTTGAGAAGATGTGG + Intergenic
1134747381 16:16598816-16598838 TGTAAGCTTTGGAGGAGATGTGG + Intergenic
1134998089 16:18754842-18754864 TGTAAGCTTTGGAGGAGATGTGG - Intergenic
1136371495 16:29839608-29839630 TGTGTGCTTCGTAGATGATGGGG - Intronic
1136415662 16:30101964-30101986 GGTCCGCGTCGGAGAAGATGGGG - Intergenic
1136627971 16:31473184-31473206 TGACTGCATCAGAGAAGATGGGG + Intronic
1138375168 16:56558436-56558458 TGCAGGCTTCGGAGAGGGTGAGG - Intergenic
1140120725 16:72081009-72081031 TGTCTGCTTGGGAGAAGATGGGG - Intronic
1146993181 17:37294764-37294786 TGTCCCCTTTGGAGAAGTTGAGG + Intronic
1150292933 17:63992132-63992154 TGTGGGCATGGGAGAAGAGGGGG + Intergenic
1151208568 17:72526780-72526802 TGGCGGATTCGGAGAGGAGGTGG - Intergenic
1155941593 18:31806286-31806308 TGTAGGCTTCGGAGGCGATCGGG - Intergenic
1156999932 18:43511725-43511747 GGTCTGCTTGGGAAAAGATGGGG + Intergenic
1158883633 18:61805095-61805117 GGTCCGCTTCAGAGAAGAAGGGG - Intergenic
1158964438 18:62610964-62610986 TGACGGCATCAGAGAAGAGGAGG + Intergenic
1162474611 19:10892488-10892510 TGTCGTCCTCGGAGAAGCTCTGG - Intronic
1163830442 19:19544924-19544946 TGTCGGCGTCGCAGAAGGCGGGG - Exonic
933371290 2:81418815-81418837 TGTGGGTTTTGAAGAAGATGTGG - Intergenic
936876642 2:117197832-117197854 TGTTGGCTTGGGACAAGTTGGGG - Intergenic
939962578 2:148578450-148578472 TGACAGCTTGGGAGAAGAGGTGG + Intergenic
943665384 2:190603473-190603495 TGTGGGGATAGGAGAAGATGAGG - Intergenic
1173519266 20:43687001-43687023 TGTGGGCCTCGCAGATGATGCGG - Exonic
1178365456 21:31985962-31985984 TGTGGGGCTCGGGGAAGATGAGG + Intronic
1179711096 21:43263636-43263658 TGTCAGTTTCGGAGGACATGGGG - Intergenic
949735850 3:7170758-7170780 TGTCAGATTAGGAGAAGATATGG + Intronic
951797545 3:26557380-26557402 TGTTGGCTTCTTAAAAGATGTGG + Intergenic
952663413 3:35877550-35877572 TGTAGGCTTCTGAGATGATTGGG + Intergenic
959917472 3:111832082-111832104 TGTAGGGCTCAGAGAAGATGTGG - Intronic
968921592 4:3524940-3524962 TGACGGCTTGGACGAAGATGGGG - Exonic
975485620 4:74932170-74932192 TGTAGGCTTTGGAGAAGCTTTGG + Intergenic
977211924 4:94228085-94228107 TGTCTACTTCTGATAAGATGAGG + Intronic
977519315 4:98060777-98060799 TGTCAGCTTTGCAGAAGATCAGG - Intronic
982245173 4:153344225-153344247 TAGCGGCTCGGGAGAAGATGAGG + Intergenic
991377245 5:65978686-65978708 TGTGGGCTTTAGGGAAGATGTGG + Intronic
994364817 5:98900810-98900832 TGTCGGATTGGGAGAAAAGGAGG - Exonic
996528094 5:124499536-124499558 TGTAGGCTTCTGAGGTGATGGGG - Intergenic
997851247 5:137334543-137334565 TGTCTGCTTTGGAGAGAATGTGG - Intronic
999629125 5:153551957-153551979 TGACTGCTTCGGAGAGGATGAGG - Intronic
1007560398 6:42803326-42803348 TGTCTGATTTGGAGCAGATGTGG + Intronic
1007901298 6:45415603-45415625 GCTGGGCTTTGGAGAAGATGTGG + Intronic
1012339734 6:98104980-98105002 TGTGGGCTAGGGGGAAGATGCGG + Intergenic
1015905794 6:138115249-138115271 GGTGGGCTTCGGAGAGGGTGGGG - Intergenic
1029491108 7:100870581-100870603 TGGTGGCTGCGGAGAAGATGTGG + Exonic
1036750792 8:11442757-11442779 TGTCGGCTTCGGAGAAGATGAGG - Intronic
1051186509 9:14466496-14466518 TGTTGGCTTCAGAGATCATGAGG + Intergenic
1056485538 9:87053369-87053391 TGTCTCCTTGGGATAAGATGGGG + Intergenic
1061075749 9:128340567-128340589 TGCCGGCTTCGGGGAAGGTGCGG + Intergenic
1061411707 9:130425526-130425548 AGGAGGCTTGGGAGAAGATGGGG - Intronic
1061559098 9:131391369-131391391 GGTCGGAGTCGGAGAAGATGTGG - Intergenic
1186480669 X:9894571-9894593 TGTCGGCTTTGGACAAGGTGTGG - Exonic
1189991538 X:46600139-46600161 TGTGGGCTTTGGAGAAGCAGAGG - Intronic
1191716832 X:64199639-64199661 TGTCATCTTCGGAGAATGTGGGG - Intronic
1197356439 X:125441684-125441706 TCTCGGCTTCGTTGAAGATCAGG + Intergenic
1200128486 X:153829255-153829277 TGTTGGCTTGGGAGAACGTGGGG - Intronic