ID: 1036750793

View in Genome Browser
Species Human (GRCh38)
Location 8:11442768-11442790
Sequence GGTGCATGTGCTGTCGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750793_1036750795 -4 Left 1036750793 8:11442768-11442790 CCGAAGCCGACAGCACATGCACC 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data
1036750793_1036750798 10 Left 1036750793 8:11442768-11442790 CCGAAGCCGACAGCACATGCACC 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1036750798 8:11442801-11442823 TAAAGACGGATATAATAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750793 Original CRISPR GGTGCATGTGCTGTCGGCTT CGG (reversed) Intronic
900031981 1:378923-378945 GGGGCATGTGGTGTCGGCATTGG + Intergenic
900052529 1:607109-607131 GGGGCATGTGGTGTCGGCATTGG + Intergenic
901143136 1:7048480-7048502 GGAGCGTCTGCTGTTGGCTTTGG + Intronic
912884703 1:113458197-113458219 GTTGCTTGTGCTGGTGGCTTGGG + Intronic
913972046 1:143423248-143423270 GGGGCATGCGCTGTCCGCCTGGG + Intergenic
919643678 1:200070234-200070256 TGTGCATTTGCTGTGGGCTTCGG + Intronic
920850777 1:209626738-209626760 GATGCATGTGGTGTGGGCCTGGG - Intronic
1064380460 10:14837764-14837786 GGCGCAGCAGCTGTCGGCTTTGG - Intronic
1065180036 10:23115520-23115542 AGTGCCTGTGCTGTTGGTTTGGG + Intronic
1070448037 10:76527216-76527238 GGTGAATGTGCTGTCTTCTGAGG + Intronic
1071281736 10:84109910-84109932 GGTGTAGGTGCTGTGGGCTCAGG - Intergenic
1073984545 10:109193385-109193407 GGGGCAAGTGCTTTGGGCTTTGG + Intergenic
1076636090 10:131882989-131883011 GGTGCATGTGGTGTGTGCTTTGG + Intergenic
1076742934 10:132496989-132497011 AATGCCTGTGCTGGCGGCTTAGG + Intergenic
1083366952 11:62147121-62147143 GCTGCATGTGCTGACCTCTTAGG + Intronic
1084940660 11:72611131-72611153 GATGCATGTGATGTGGACTTGGG + Intronic
1085279008 11:75318109-75318131 AGTGGATGTGATGTCGGCCTGGG + Intronic
1085458520 11:76679218-76679240 GGTGCAGGTGGTGGGGGCTTTGG + Intergenic
1088250718 11:107858833-107858855 GGTGCCTGTGCGGCCGGCTGGGG + Exonic
1090138421 11:124225435-124225457 GCTGCAAGTGCTGAAGGCTTTGG - Intergenic
1090141225 11:124265635-124265657 GCTGCAAGTGCTGAAGGCTTTGG - Exonic
1090156105 11:124440360-124440382 GCTGCAGGTGCTGAAGGCTTTGG + Exonic
1090167900 11:124570820-124570842 GCTGCAGGTGCTGAAGGCTTTGG - Exonic
1097958842 12:65513060-65513082 GGGGCATGAACTGTAGGCTTCGG + Intergenic
1109802511 13:67398645-67398667 GTTGTAGGTGCTGTGGGCTTAGG - Intergenic
1114656201 14:24316959-24316981 GGTACATGTGCTGTGGGTATCGG + Exonic
1118671336 14:68131345-68131367 TGTGCTTGTGATGTGGGCTTTGG + Intronic
1119702951 14:76767748-76767770 GGTGCAGGTGCTGTCTGCAGTGG + Intronic
1121335148 14:93073359-93073381 GGTGCCTGTGCTGGAGGCTGAGG - Intronic
1124201085 15:27679103-27679125 GATGCTGGTGCTGTCGGCTGTGG - Intergenic
1128246167 15:66134286-66134308 GGTGCAGATGCTGCCTGCTTGGG - Intronic
1144338655 17:14295668-14295690 GGTGCAGGTGCTGTATGCATTGG - Intergenic
1145400394 17:22527378-22527400 GGTGCATGAGCTGGAGTCTTGGG + Intergenic
1145797246 17:27662851-27662873 TCTGAATGTGCTGTTGGCTTCGG + Intergenic
1146308589 17:31749918-31749940 GGTGCGTGTGCTGCTGGTTTGGG - Intergenic
1149001609 17:51763278-51763300 GGAGCATGTGCTGTGGGGGTGGG + Intronic
1152132334 17:78484878-78484900 GGTCCATGTGCTGCCGGATGAGG + Exonic
1152520777 17:80855378-80855400 GCTGCATGAGCTGCCAGCTTTGG - Intronic
1152947672 17:83206791-83206813 GGGGCATGTGGTGTCGGCATTGG - Intergenic
1153056338 18:949909-949931 GGAGCATGTGCTTTGGGCCTTGG + Intergenic
1154306680 18:13235680-13235702 GTTGCATATGCGATCGGCTTTGG + Intronic
1160678096 19:401065-401087 GGTGCAGGTGCCGTGGGCTGGGG + Intergenic
1161136862 19:2625041-2625063 GGTGCATGTGTTGTCCCCTGGGG + Intronic
1162786904 19:13040670-13040692 GGTACATGTGCTTGCGGCTCTGG + Intronic
925757536 2:7148139-7148161 AGTGCATGTGCTGTAGACTCAGG + Intergenic
925759031 2:7166384-7166406 GGTGCATGTGTTGTCAGCAGAGG + Intergenic
929828564 2:45329392-45329414 GCTGCATGTGCTTCAGGCTTGGG + Intergenic
934176745 2:89584185-89584207 GGGGCACGTGCTGTCCGCCTGGG + Intergenic
934765448 2:96877808-96877830 GGTGGATGTGCTGGTGGCTCTGG + Intronic
939877277 2:147592271-147592293 GGTGTATGTGCTGTAGGATCTGG - Intergenic
1171209508 20:23306037-23306059 GGTGTATGTGCTGCCGGAGTAGG - Intergenic
1174097557 20:48101412-48101434 GGTGCATGTGCTGTGGGCAAAGG - Intergenic
1175920364 20:62447817-62447839 GGTGCATGGGTTGTGGTCTTGGG + Intergenic
1182963931 22:34504141-34504163 GCTGGATGTGCTGTCACCTTAGG + Intergenic
1183426679 22:37743515-37743537 GGAGGATGTGCTGTGGGCTTAGG + Intronic
1183518804 22:38284213-38284235 GGCGCTTGTGCTGTAGGCTCTGG + Intergenic
1185203985 22:49526249-49526271 GGGGCATGTGCTGTGAGCTTGGG + Intronic
949866055 3:8548636-8548658 GGTGCATGAGCTGGCGGCGGCGG - Exonic
952933442 3:38376991-38377013 GGTACATGTGCTGTTGGTGTTGG + Exonic
958988207 3:100808211-100808233 GGAGCACGTGGTGTCTGCTTGGG + Exonic
960208361 3:114930582-114930604 GCTGCAGGTGGTGCCGGCTTGGG - Intronic
963147923 3:142013973-142013995 GGAGGATGTGATGTAGGCTTGGG - Intronic
964522897 3:157586517-157586539 GGTGTAGGTGCTGTGGGCTCAGG + Intronic
966914209 3:184575908-184575930 GGTGCAGATGCTGGCGGCTGGGG - Exonic
969535763 4:7755347-7755369 GGGGCCTGGGCTGTTGGCTTTGG - Intergenic
970947287 4:21709963-21709985 GTTGCATGTGCTGGCAGCTCTGG - Intronic
972235284 4:37125237-37125259 GGTGAATTAGCTGTGGGCTTAGG - Intergenic
977258190 4:94763480-94763502 GCTGCATGTGGCGTCAGCTTTGG + Intronic
989816095 5:45739311-45739333 GGAGCATGTGCAGTCCACTTTGG + Intergenic
993441612 5:87963306-87963328 GGAGGATGTGCTGTGGACTTAGG - Intergenic
997972926 5:138419053-138419075 GATGTCAGTGCTGTCGGCTTTGG - Exonic
1001710521 5:173774422-173774444 GGAGCATGTGCTGTGTCCTTGGG - Intergenic
1002741839 5:181439945-181439967 GGGGCATGTGGTGTCGGCATTGG - Intergenic
1002911182 6:1491906-1491928 GGTGAGTGTCCTGTTGGCTTTGG - Intergenic
1003220952 6:4160618-4160640 GGTGCCTGTGCTGGGTGCTTGGG + Intergenic
1004122353 6:12836634-12836656 GCTGAATGTGCTGCAGGCTTAGG - Intronic
1006314847 6:33284477-33284499 GGTGGAGGTGGTGTCTGCTTTGG - Intronic
1008691334 6:53982478-53982500 AGTGCATTTGCTGTTTGCTTTGG + Intronic
1014547236 6:122747776-122747798 GGTGGAGGTGCTGTGGGCTCAGG + Intergenic
1015325570 6:131919270-131919292 GTTGGATGTGGTGTTGGCTTGGG - Intergenic
1019246980 6:170715702-170715724 GGGGCATGTGGTGTCGGCATTGG - Intergenic
1021762922 7:23918884-23918906 GGTCCACATGCTGTCTGCTTTGG + Intergenic
1024958800 7:54954008-54954030 GGGGCATGTGCTTTTGCCTTGGG - Intergenic
1029255495 7:99266795-99266817 GTTTTATGTGCTGTCAGCTTGGG + Intergenic
1031514199 7:122682085-122682107 GGAGTATTTGCTGTTGGCTTAGG - Intronic
1033453779 7:141484103-141484125 TGTACATCTGCTGTCAGCTTTGG - Intergenic
1034275786 7:149823273-149823295 GCGGCATGTGCTCTGGGCTTTGG + Intergenic
1035348819 7:158228650-158228672 GATGCTTTTGCTGTCTGCTTGGG - Intronic
1035501161 8:92251-92273 GGGGCATGTGGTGTCGGCATTGG + Intergenic
1035549076 8:506349-506371 GGAGCCTGTGCTGTTGGCTGTGG - Intronic
1035742332 8:1937803-1937825 GCTGCATGTGATCTGGGCTTGGG + Intronic
1035964524 8:4175926-4175948 TGTGCAGGTGCTGTCGACATTGG + Intronic
1036750793 8:11442768-11442790 GGTGCATGTGCTGTCGGCTTCGG - Intronic
1045517052 8:102869001-102869023 GGTGCAAATGATGTTGGCTTAGG - Intronic
1049044318 8:140137285-140137307 GGAGCATGTGGTCTCTGCTTTGG - Intronic
1061743016 9:132721207-132721229 GGTGCATATGCTGTCTTGTTTGG + Intergenic
1061798532 9:133102186-133102208 GGTGCAGGGGCTGTGGGGTTGGG - Intronic
1062263865 9:135677873-135677895 GGTGCCTGTGCTGACGGCAGCGG + Intergenic
1203607751 Un_KI270748v1:71161-71183 GGGGCATGTGGTGTCGGCATTGG - Intergenic
1186602156 X:11049682-11049704 GTAGTATTTGCTGTCGGCTTTGG - Intergenic
1192399338 X:70818597-70818619 GGTGCATTGGTTGTGGGCTTTGG - Intronic
1193649565 X:84113430-84113452 TTTGCATGTGCTGTTGGATTTGG - Intronic
1194020436 X:88683893-88683915 GGTGAATGTGCTGGCAGATTGGG + Intergenic
1200014384 X:153147457-153147479 TGTGCATGTGCTGGAGGCTGGGG + Intergenic
1200025218 X:153252497-153252519 TGTGCATGTGCTGGAGGCTGGGG - Intergenic
1200394577 X:155976206-155976228 GGTGTAGGTGCTGTGGGCTCAGG + Intergenic
1200942949 Y:8804469-8804491 GGTGGAGGTGCTGTGGGCTTAGG - Intergenic