ID: 1036750794

View in Genome Browser
Species Human (GRCh38)
Location 8:11442774-11442796
Sequence CGAGAGGGTGCATGTGCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750794_1036750799 27 Left 1036750794 8:11442774-11442796 CCGACAGCACATGCACCCTCTCG 0: 1
1: 1
2: 0
3: 10
4: 147
Right 1036750799 8:11442824-11442846 TGTGTTCTGAGAAGCACTCTCGG No data
1036750794_1036750798 4 Left 1036750794 8:11442774-11442796 CCGACAGCACATGCACCCTCTCG 0: 1
1: 1
2: 0
3: 10
4: 147
Right 1036750798 8:11442801-11442823 TAAAGACGGATATAATAGAATGG No data
1036750794_1036750795 -10 Left 1036750794 8:11442774-11442796 CCGACAGCACATGCACCCTCTCG 0: 1
1: 1
2: 0
3: 10
4: 147
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750794 Original CRISPR CGAGAGGGTGCATGTGCTGT CGG (reversed) Intronic
902511977 1:16971620-16971642 CCAGAGGGTGCGTGGGCTGGAGG + Exonic
903337965 1:22637487-22637509 CCAGAGGGTGCATGTGCACTTGG + Intronic
903447657 1:23432527-23432549 GGAGAGGGAGCATGTCCTGCTGG - Intronic
904699447 1:32349713-32349735 TGAGAGAATGCATGTGTTGTCGG - Intergenic
906705574 1:47892673-47892695 CAAGAAGGGGCATGTGCTGATGG + Intronic
907251563 1:53142998-53143020 TGGGTGGGTGCATGTGCTGCGGG + Intergenic
909532063 1:76692666-76692688 GCAGAGGGTAAATGTGCTGTTGG - Intergenic
915558405 1:156672992-156673014 GGAGAGGGTGCCTGAGGTGTGGG + Exonic
917535346 1:175870557-175870579 CCAGAAGCAGCATGTGCTGTGGG + Intergenic
920529178 1:206689369-206689391 GGAGATGGTGCCTGTACTGTGGG - Intronic
921285947 1:213609508-213609530 TGTGAGGGTGATTGTGCTGTTGG - Intergenic
924828019 1:247562353-247562375 CCAGAGGATGCATGTGGTGGAGG + Intronic
1063569652 10:7203539-7203561 TGGGAGGGTGCAAGTGCTTTGGG - Intronic
1067842456 10:49691821-49691843 AGTGAGGGTGCATGGACTGTGGG - Intronic
1068789918 10:61017033-61017055 GGAAAGGGGGCATATGCTGTGGG + Intergenic
1069729285 10:70600675-70600697 ACAGAGGGTGCAGGTGCCGTCGG + Exonic
1070153358 10:73818742-73818764 GGAGAGGGTGTGTGTGTTGTGGG - Intronic
1070267247 10:74915742-74915764 CAAAAGGTTGCATGTGCTGGTGG + Intronic
1071920256 10:90341836-90341858 CAATAGGGTGCATGTGGAGTCGG + Intergenic
1075236462 10:120735392-120735414 GGAGAGGGTGGATGTACTTTGGG + Intergenic
1076295365 10:129379817-129379839 CAAGAGGGTGCAGCTGCTGAGGG - Intergenic
1076750758 10:132541659-132541681 TGAGGGGGTGCCTGTGATGTGGG - Intronic
1076803041 10:132841371-132841393 CCAGAGGCAGCAGGTGCTGTCGG - Intronic
1076843035 10:133055956-133055978 CCTGTGGGTGCAGGTGCTGTTGG + Intergenic
1077590706 11:3488879-3488901 TGAGGGGGTCCATGTACTGTGGG + Intergenic
1083719621 11:64597951-64597973 CCAGAGGGCGCTGGTGCTGTTGG + Intronic
1084246427 11:67860664-67860686 TGAGGGGGTCCATGTACTGTGGG + Intergenic
1084826254 11:71733837-71733859 TGAGGGGGTCCATGTACTGTGGG - Intergenic
1085039119 11:73316748-73316770 TGAGATGGGGCAGGTGCTGTTGG + Intronic
1085045391 11:73349774-73349796 GGAGAGGGTGCAGGACCTGTGGG + Intronic
1086012593 11:82123357-82123379 TGAGAGGGTGTATGTGTTGAGGG - Intergenic
1086137435 11:83456252-83456274 AGCGATGATGCATGTGCTGTGGG - Intronic
1087925534 11:103914364-103914386 TGAGAGGGTGTATGTGTTTTGGG - Intronic
1091320112 11:134643394-134643416 AGAGAGGATGCATGTGGTCTGGG - Intergenic
1092416989 12:8297786-8297808 TGAGGGGGTCCATGTACTGTGGG + Intergenic
1095145674 12:38722935-38722957 CGAGAGAGTGCATGTGAAGGAGG - Intronic
1096549649 12:52363765-52363787 AGAGAGTGTGCATGTGTGGTGGG - Intronic
1098741995 12:74184685-74184707 GGTCAGGGTGCATGTGGTGTTGG - Intergenic
1101512154 12:105403186-105403208 CCAGAGGGTTAAGGTGCTGTAGG + Intergenic
1101947662 12:109150256-109150278 CGAGTGGGAGCAAGTGCTGGGGG + Intronic
1103320660 12:120091032-120091054 CGAGACGGTGGATGGGATGTAGG - Intronic
1103429907 12:120874710-120874732 CGAGAGGGTGTGTGTGATGTGGG + Intronic
1104927243 12:132320180-132320202 CGCGTGTGTGGATGTGCTGTGGG - Intronic
1105237463 13:18571679-18571701 TGAGAGGGAGCCTATGCTGTTGG + Intergenic
1108432187 13:50365456-50365478 TGAGAGGGTGCTTGTTCTGAGGG + Intronic
1113952881 13:114081433-114081455 CACGAGAGTGCATGTGCTGGTGG - Intronic
1114504106 14:23195654-23195676 TAGGAGGGTGGATGTGCTGTCGG - Intronic
1118331033 14:64816200-64816222 AGAGAGGGAGCATTAGCTGTGGG - Intronic
1122803514 14:104244951-104244973 GTGGAGGGGGCATGTGCTGTTGG + Intergenic
1123994385 15:25708157-25708179 CGCGAGGGTGCACGTGCAGGTGG - Intronic
1124789626 15:32716027-32716049 AGAGAGGGGGCGTGTGTTGTGGG + Intergenic
1126252720 15:46587995-46588017 CCAGATGGTGCATGTGGTGCTGG + Intergenic
1127688927 15:61375859-61375881 CCAGAGGGGGCATGGGCTCTAGG - Intergenic
1128451896 15:67810703-67810725 AGGGAGGGTGCCTGTGGTGTGGG + Intergenic
1129869527 15:78931740-78931762 TGAGAGGGGGCAAGGGCTGTTGG + Intronic
1134114775 16:11539639-11539661 GGAGAGAGTGCAGGTGCTGGTGG - Intergenic
1134214043 16:12302149-12302171 CCAGAGGGTGGATGTGTTGGTGG + Intronic
1137787356 16:51150398-51150420 GCAGAGGGTGCAAGTGTTGTGGG + Intronic
1138590511 16:57997080-57997102 CGAGGGTGTGCACGTGCTGGTGG + Exonic
1140202128 16:72903280-72903302 CCAGAGGGTGCTGTTGCTGTTGG - Intronic
1140473156 16:75226093-75226115 CCAGAGGGTGCAGGGGCTGGGGG - Intergenic
1142805642 17:2369822-2369844 GGGGAGGGTGCAGGTGCAGTGGG - Intronic
1146271644 17:31488916-31488938 GGAGAGCGTGTCTGTGCTGTGGG + Intronic
1147653413 17:42074758-42074780 TTAGAGGATGCGTGTGCTGTGGG - Intergenic
1149488666 17:57065741-57065763 CGAGAGCTTGCATTTGCTGAGGG - Intergenic
1150626188 17:66842643-66842665 AGAGAGGCTGCAAGAGCTGTGGG - Intronic
1152217608 17:79042919-79042941 CGTGAGTGTGCATGTGATGTGGG + Intronic
1152217622 17:79043275-79043297 TGAGAGTGTGCATGTGATTTGGG + Intronic
1152217631 17:79043490-79043512 CATGAGTGTGCATGTGATGTGGG + Intronic
1152938082 17:83152242-83152264 CGAGGAGGTGAATGTGCTGCTGG + Intergenic
1153977096 18:10279007-10279029 AGACATGGAGCATGTGCTGTTGG + Intergenic
1156476119 18:37406476-37406498 AAAGAGGGTGAATGTGCTGCTGG + Intronic
1166260206 19:41633689-41633711 GGAGAGGCTGCAGGTGCTGAGGG - Intronic
1166893549 19:46009076-46009098 GGAAAGGGAGCCTGTGCTGTGGG + Intronic
1168159637 19:54501116-54501138 CGGGATTTTGCATGTGCTGTTGG + Intronic
1168169139 19:54574734-54574756 TGAGAGGGTGGGTTTGCTGTAGG - Exonic
926704529 2:15827265-15827287 AGGCAGGGTGCATGTGCTGGAGG - Intergenic
927440328 2:23111589-23111611 AGAAAGTGTGCATGTGTTGTGGG + Intergenic
927553950 2:24019803-24019825 CTAGAGGGTGCCAGTGCTGGAGG - Intronic
929794370 2:45047646-45047668 AGAGGGTGTGCATGTGCTGGAGG - Intergenic
932318288 2:70801079-70801101 CACGAGGGTCCATGTGCTTTAGG - Intergenic
932563396 2:72891129-72891151 CTAGAGGGTCCATGTTCAGTGGG + Intronic
934524269 2:95042000-95042022 TGAGAGGGTGCATGGGCGTTTGG - Intronic
938512310 2:131962819-131962841 TGAGAGGGAGCCTATGCTGTTGG - Intergenic
939877278 2:147592277-147592299 GGAGAAGGTGTATGTGCTGTAGG - Intergenic
940848252 2:158663704-158663726 CCACAGGATGTATGTGCTGTGGG + Intronic
943152053 2:184126176-184126198 AGAGAGTGTGCAAATGCTGTGGG - Intergenic
947482018 2:230509549-230509571 AGAGAGGGTGCCTGTGATGAAGG - Intronic
1170348327 20:15412130-15412152 CCAAAAGGTGCAAGTGCTGTTGG + Intronic
1175009426 20:55720154-55720176 TGAGAGGGTACATGGGCTCTTGG + Intergenic
1175762549 20:61571402-61571424 CCAGAGGGTACCTGGGCTGTAGG + Intronic
1176045878 20:63092335-63092357 CGTGAGTGTGCATGTGGGGTGGG + Intergenic
1176191926 20:63815536-63815558 CCAGTGGGTGCAGGTGCAGTGGG + Intronic
1176191958 20:63815713-63815735 CGAGTGGGTGCAGGTGCAGTAGG + Intronic
1176191985 20:63815874-63815896 CCAGTGGGTGCAGGTGCAGTGGG + Intronic
1176781452 21:13199957-13199979 TGAGAGGGAGCCTATGCTGTTGG + Intergenic
1177581040 21:23021847-23021869 CGAGAGGGAGCAAGGGCTGCTGG + Intergenic
1177979153 21:27889106-27889128 TGAGAGGGAGCCTATGCTGTTGG + Intergenic
1179985920 21:44920203-44920225 CGAGTGTGCGCATGTGATGTGGG - Intronic
1180595987 22:16973715-16973737 AGAGTGAGTGCATGTGCTGATGG - Intronic
1180676135 22:17587688-17587710 CAAGAGGCTGCAGGTGCTGCAGG + Intronic
1180913901 22:19472160-19472182 CCAGATGCTGCAGGTGCTGTGGG + Intronic
1183544375 22:38447736-38447758 GGAGAGGGTGCATGTGCTGTGGG - Intronic
1185005380 22:48273218-48273240 CAAGACTGTGCATGTGCTATAGG + Intergenic
951253663 3:20424047-20424069 CTAGAAGGAGCATGTGCGGTAGG - Intergenic
952933441 3:38376985-38377007 CCACAAGGTACATGTGCTGTTGG + Exonic
954810316 3:53243402-53243424 CCAGATGGTGCATGTGCCCTTGG - Intronic
956134880 3:66088802-66088824 CAAGAGGGTGGATGCCCTGTTGG + Intergenic
956683061 3:71799454-71799476 AGAGAGGGTGCCTGAGCTGTTGG - Intergenic
957060728 3:75479402-75479424 TGAGGGGGTCCATGTACTGTGGG + Intergenic
961292647 3:125859999-125860021 TGAGGGGGTCCATGTACTGTGGG - Intergenic
961861403 3:129919240-129919262 GGAGAGGGTGGGAGTGCTGTGGG + Intergenic
961894539 3:130156388-130156410 TGAGGGGGTCCATGTACTGTAGG + Intergenic
967865482 3:194186665-194186687 GGAGAAGGTGTATGTGCAGTAGG - Intergenic
969004633 4:4009466-4009488 TGAGGGGGTCCATGTACTGTGGG + Intergenic
969809264 4:9635241-9635263 TGAGGGGGTCCATGTACTGTGGG - Intergenic
970268277 4:14313994-14314016 GGAGAAGCTGCACGTGCTGTCGG - Intergenic
971214739 4:24652498-24652520 CGAGGGGCTGCATCTGGTGTGGG + Intergenic
971650985 4:29273715-29273737 CAAGAGTGTGGATGTCCTGTAGG - Intergenic
972115058 4:35621302-35621324 CAAGAGAGAACATGTGCTGTTGG - Intergenic
979763180 4:124432542-124432564 CCAGATGGTGCCTATGCTGTTGG - Intergenic
981316412 4:143344111-143344133 AGAGAGGGAGCATGTTCTGGTGG + Intronic
985658707 5:1145025-1145047 GGGGAAGGAGCATGTGCTGTCGG + Intergenic
985822029 5:2166961-2166983 CCTGAGGGTCCGTGTGCTGTGGG - Intergenic
987124467 5:14798565-14798587 AGAGAGTGAGCATGTGCTTTTGG - Intronic
988208685 5:28173962-28173984 TGAAAGGGTGAATGTCCTGTTGG + Intergenic
989501602 5:42175180-42175202 CGAGAGGCTGCATCTGCTGAGGG + Intergenic
992625715 5:78634311-78634333 CGTGAGGGTGGCTGTGCTGCAGG + Intronic
997488800 5:134255082-134255104 AGAGACGGTGCATGAGCTGTGGG - Intergenic
1000242411 5:159420747-159420769 CGAGGGGCTGCATGTGGTGAGGG + Intergenic
1002270866 5:178071047-178071069 GGCCAGGGTGCATGTACTGTTGG - Intergenic
1002782963 6:380886-380908 AGGGAGGGAGCATGTGCAGTAGG + Intergenic
1009664395 6:66655877-66655899 CGAGAGAGAGCAAGGGCTGTGGG + Intergenic
1014368265 6:120572748-120572770 GGAGAGGGTGAATGTGCATTAGG - Intergenic
1014450323 6:121574173-121574195 GTAGAGGGGGCATGTGCTGATGG + Intergenic
1017277022 6:152581553-152581575 CGAGAGGGGCCATGAGCAGTGGG - Intronic
1018792791 6:167162367-167162389 CTAGAAGGTGCATCTGCAGTGGG + Intronic
1022652876 7:32293305-32293327 TGAGAGGTTGTATTTGCTGTGGG - Intronic
1023000841 7:35806037-35806059 CCAGAGAGAGCATGTGCTGCTGG - Intronic
1034566325 7:151918526-151918548 CTAGCGGGTGCAGGTGCTGCAGG + Intergenic
1035109094 7:156465356-156465378 CGGGTGGCTGCAGGTGCTGTGGG - Intergenic
1035549077 8:506355-506377 TGAGAGGGAGCCTGTGCTGTTGG - Intronic
1035723355 8:1809721-1809743 CCAGAAGGTGCCTGTGCTGTTGG - Intergenic
1035904587 8:3495812-3495834 AAGGAGGGTGCATATGCTGTAGG - Intronic
1036750794 8:11442774-11442796 CGAGAGGGTGCATGTGCTGTCGG - Intronic
1038011519 8:23480255-23480277 CGGGAGGGTCCAGGTGCTGCAGG - Intergenic
1038712336 8:29959151-29959173 CGAGAGGGAGCATGTGAAGGAGG + Intergenic
1042686762 8:71450616-71450638 ACAAAGGGAGCATGTGCTGTTGG + Intronic
1043356530 8:79419519-79419541 CAAGATGCTGCATGTGCTGCTGG + Intergenic
1045025160 8:98080062-98080084 TGCAAGGGTGCATGTGATGTTGG - Intronic
1045551991 8:103181092-103181114 GGAAAGGGTGGAGGTGCTGTAGG + Intronic
1046983233 8:120359933-120359955 CGAGAGGGAGGAAGTGCAGTAGG - Intronic
1049851019 8:144830200-144830222 CGAGAGAGTGCCTGGGCTGGGGG + Intronic
1053504170 9:38627089-38627111 AGAGGGGAGGCATGTGCTGTTGG + Intergenic
1187291970 X:17963337-17963359 CAAGAGGCTGCATGTGGTGAGGG + Intergenic
1193069703 X:77295029-77295051 TGCGAGGGTGTAGGTGCTGTGGG - Intergenic
1194377783 X:93156623-93156645 GGAGAATGTCCATGTGCTGTTGG - Intergenic
1194810964 X:98386938-98386960 TAAGAGGGTTCATGGGCTGTAGG + Intergenic
1196996913 X:121394261-121394283 TGTGAGGATGCATGTGTTGTCGG + Intergenic