ID: 1036750795

View in Genome Browser
Species Human (GRCh38)
Location 8:11442787-11442809
Sequence CACCCTCTCGTTACTAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036750792_1036750795 7 Left 1036750792 8:11442757-11442779 CCTCATCTTCTCCGAAGCCGACA 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data
1036750790_1036750795 17 Left 1036750790 8:11442747-11442769 CCCGCAGGTGCCTCATCTTCTCC 0: 1
1: 0
2: 4
3: 38
4: 415
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data
1036750793_1036750795 -4 Left 1036750793 8:11442768-11442790 CCGAAGCCGACAGCACATGCACC 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data
1036750794_1036750795 -10 Left 1036750794 8:11442774-11442796 CCGACAGCACATGCACCCTCTCG 0: 1
1: 1
2: 0
3: 10
4: 147
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data
1036750791_1036750795 16 Left 1036750791 8:11442748-11442770 CCGCAGGTGCCTCATCTTCTCCG 0: 1
1: 0
2: 3
3: 106
4: 359
Right 1036750795 8:11442787-11442809 CACCCTCTCGTTACTAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036750795 Original CRISPR CACCCTCTCGTTACTAAAGA CGG Intronic
No off target data available for this crispr