ID: 1036751359

View in Genome Browser
Species Human (GRCh38)
Location 8:11445451-11445473
Sequence CTGCAGCTGTGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 1, 2: 4, 3: 69, 4: 563}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036751353_1036751359 9 Left 1036751353 8:11445419-11445441 CCTCACCTCTTCAGAGACAGAAG 0: 1
1: 0
2: 4
3: 30
4: 333
Right 1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 69
4: 563
1036751351_1036751359 26 Left 1036751351 8:11445402-11445424 CCAAGAACAACACCTTACCTCAC 0: 1
1: 0
2: 0
3: 6
4: 147
Right 1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 69
4: 563
1036751350_1036751359 29 Left 1036751350 8:11445399-11445421 CCTCCAAGAACAACACCTTACCT 0: 1
1: 0
2: 1
3: 9
4: 231
Right 1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 69
4: 563
1036751354_1036751359 4 Left 1036751354 8:11445424-11445446 CCTCTTCAGAGACAGAAGCAAAT 0: 1
1: 0
2: 2
3: 31
4: 282
Right 1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 69
4: 563
1036751352_1036751359 14 Left 1036751352 8:11445414-11445436 CCTTACCTCACCTCTTCAGAGAC 0: 1
1: 0
2: 4
3: 26
4: 233
Right 1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG 0: 1
1: 1
2: 4
3: 69
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036751359 Original CRISPR CTGCAGCTGTGGAGGGAAGA AGG Intronic
900002779 1:24033-24055 CTGCATCTGTTCAGGGGAGATGG - Intergenic
900022500 1:194558-194580 CTGCATCTGTTCAGGGGAGATGG - Intergenic
900385323 1:2407955-2407977 CAACGGCTGTGGAGGGGAGAAGG + Intronic
900418542 1:2545952-2545974 CTCCAGCTGTGGAAGCAACAGGG - Intergenic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
901930933 1:12595773-12595795 GTGCAGCTGGGGAGGGGACAGGG + Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902895593 1:19477645-19477667 CTGCAACTGAGAAGGGAAAAGGG + Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
903489136 1:23714658-23714680 TTTCAGCTGTGGAGGGCATATGG + Intergenic
904757402 1:32775715-32775737 CTCCAGCTGCCAAGGGAAGAAGG + Exonic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905458547 1:38105498-38105520 ATGGAGCTGTGGAGGGAATGTGG + Intergenic
905516326 1:38564642-38564664 TGGCAGAGGTGGAGGGAAGAAGG + Intergenic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
906150580 1:43585207-43585229 CTGCAGCAGTGGGTGGAGGATGG + Intronic
906896531 1:49779330-49779352 CTGCAACAGTGCAAGGAAGAAGG + Intronic
907866206 1:58401741-58401763 CAGAAGCTGTGAAAGGAAGAAGG - Intronic
907870429 1:58437987-58438009 CTGCACATATGGAGGGAACATGG - Intronic
908602749 1:65758773-65758795 CTGACACTGTGGAAGGAAGATGG + Intergenic
909044939 1:70698540-70698562 ATGAATCTGTGGAGGGAAGATGG + Intergenic
909125123 1:71658042-71658064 CTGGAGCTGTGCAGGGATCATGG - Intronic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910471699 1:87560243-87560265 GTGCAGCTTTGCTGGGAAGAGGG - Intergenic
910643403 1:89488824-89488846 CTGCTGCTGGCGAGGGGAGAGGG - Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
912701566 1:111882033-111882055 CAGCAGCTGTAGAGGGAGGCAGG + Intronic
913215646 1:116617889-116617911 CTGCAGCTGTGGGAGGAGGTGGG - Intronic
913217462 1:116632343-116632365 ATGGATCTGTGGGGGGAAGAAGG + Intronic
914003560 1:143713020-143713042 AGGCAGCTGAGGAGGGAAGAAGG - Intergenic
914094779 1:144535486-144535508 AGGCAGCTGAGGAGAGAAGAAGG - Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914303743 1:146398412-146398434 AGGCAGCTGAGGAGAGAAGAAGG + Intergenic
914516000 1:148374769-148374791 AGGCAGCTGAGGAGAGAAGAAGG - Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917112483 1:171563171-171563193 CTACAGATGTGGAGAGAAAATGG - Intronic
917273623 1:173305862-173305884 CCGCACATGTGGAGGGAAGGAGG - Intergenic
917489382 1:175484793-175484815 GGTCAGCTGTGGATGGAAGAAGG + Intronic
917748586 1:178034702-178034724 CACCAGGTGTGAAGGGAAGATGG + Intergenic
919320431 1:196030161-196030183 AGGCAGCTAGGGAGGGAAGATGG + Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
921165009 1:212500553-212500575 CTCCTCCTGTGGAGGGGAGAGGG + Intergenic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
921929544 1:220743881-220743903 CTTCAGCTTTGAAAGGAAGATGG - Intergenic
922180894 1:223231814-223231836 CTCCAGCAGTGCAGGGAAGGGGG - Intronic
922859515 1:228804185-228804207 CAGAAGCTGGGAAGGGAAGAAGG - Intergenic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
922966494 1:229695166-229695188 CTGCAGCAGTGCATGGCAGAAGG - Intergenic
923361162 1:233212539-233212561 ATGCAGTTGTCCAGGGAAGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923469471 1:234277952-234277974 GGGAAGCTGAGGAGGGAAGATGG + Intronic
923678457 1:236100182-236100204 ATGCAGAGGTGGTGGGAAGAAGG - Intergenic
923747530 1:236716349-236716371 CAGCAGCTGTTGTGGGATGAGGG + Intronic
923778752 1:237002620-237002642 AAGCAGCTGTGGTGGGCAGAAGG - Intergenic
924329089 1:242924451-242924473 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
1062972862 10:1661891-1661913 CTGCTGCTGGGGAGGGAAAGGGG + Intronic
1063502026 10:6563842-6563864 GTGCAGTTGGGGAGGGAGGAAGG + Intronic
1065101572 10:22336453-22336475 CTGCAGCTGTGCGGCAAAGACGG - Intergenic
1065281451 10:24143206-24143228 CTGCAGCTGTGGTGTCCAGAGGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066240062 10:33524861-33524883 CTGCAGCTGTGTGGGGCAGGAGG - Intergenic
1068226123 10:54108736-54108758 CTTCTGCTGAGGAGAGAAGAGGG + Intronic
1069828030 10:71266181-71266203 CTGCAGCTGTGAGGGGAACCAGG + Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1071368137 10:84922370-84922392 CTGTATCTGTGGAGGGACAATGG + Intergenic
1072323675 10:94275211-94275233 GTACAGCTGCAGAGGGAAGAGGG - Intronic
1072921412 10:99580048-99580070 AGGCAGCTGTGGAGAGAGGATGG + Intergenic
1073058967 10:100721898-100721920 CCACAGCTCTGGAAGGAAGAGGG + Intergenic
1073522267 10:104144055-104144077 CTTCAGCTGGAAAGGGAAGAAGG + Intronic
1073780191 10:106829379-106829401 CAGCAGCTGTGAATGTAAGAGGG - Intronic
1074885396 10:117689159-117689181 CCCCAGTTGTGGAGGGAGGAAGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075163401 10:120044214-120044236 CTGGAGCTGTTGAGGGAGGGTGG - Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076261851 10:129072781-129072803 CTGAAGCTGTGAAGACAAGAAGG + Intergenic
1077442207 11:2574151-2574173 CTGCAGCTGTGGGGGGAGATGGG - Intronic
1077503157 11:2918263-2918285 CTGCAGGTGTGCAGTGTAGAGGG - Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1077718282 11:4602407-4602429 CTGTATCTGTGGAGCCAAGATGG + Exonic
1078324754 11:10370395-10370417 CTGGAGCTGGAGAGGGCAGAGGG + Intronic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079085668 11:17443117-17443139 CTGCTGCTGTCGAGGGAAGGAGG + Intronic
1079106408 11:17575011-17575033 CTGCAACTGTGAGGGGAAGGAGG - Intronic
1079154338 11:17930504-17930526 CTGCAGCCATGGGGAGAAGATGG + Intronic
1079321590 11:19455995-19456017 CTGCAGAGGGGGAGGGAAGGAGG + Intronic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1079784678 11:24656819-24656841 CTCCAGCTGAGGAGAGATGAGGG - Intronic
1080134723 11:28841396-28841418 CAGCACCTGTGAATGGAAGAGGG - Intergenic
1080681979 11:34485951-34485973 CTGCAGCTGGTGGGGGATGAGGG + Intronic
1081206413 11:40280820-40280842 CGGAAGCTGTGGATGGAAGCAGG - Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1081977596 11:47245567-47245589 CAGCAGCTGTAGAGCGAAGCGGG + Exonic
1082645194 11:55715179-55715201 TTGCAACTGTGTAGAGAAGAGGG - Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083960693 11:66013300-66013322 CAGCTTCTGTGGAGGGAATATGG - Exonic
1084272838 11:68038391-68038413 CTGCAGCCGCGGGGGGTAGAGGG - Intergenic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1084617032 11:70243289-70243311 CTGCAGCAGAGCAGGGAAGTGGG + Intergenic
1084620988 11:70270406-70270428 CTGCAGCCGTGGGGGGAAACTGG + Intergenic
1084914021 11:72414279-72414301 CAGCAGCTGTGGTGGTGAGAAGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085803297 11:79611533-79611555 CTGCAGCTGGCAGGGGAAGATGG - Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1087002084 11:93431380-93431402 CTGGAGCTTAGAAGGGAAGAGGG + Intronic
1087290647 11:96316809-96316831 TTGCAGCAGTCGAGGGGAGAGGG + Intronic
1087513377 11:99127057-99127079 CTGAAGCTGTAGAGGTAAGTTGG - Intronic
1088586374 11:111363277-111363299 CTCCAGCTGAGCAGGTAAGAAGG + Intronic
1088678147 11:112216214-112216236 TTGCAGGTTTGGAGAGAAGATGG + Exonic
1088713258 11:112527027-112527049 CTCCAGATGTCTAGGGAAGAAGG + Intergenic
1089423537 11:118350449-118350471 ATGCCGCTGTGGAGGGCAGCAGG - Intronic
1089680863 11:120118179-120118201 AGGCAGCTGTGGAGGAAAGCAGG + Intronic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091376198 12:26096-26118 CTGCATCTGTTCAGGGGAGATGG - Intergenic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1092069302 12:5619841-5619863 CTGCAGCTGGCGAGGGAAACTGG + Intronic
1092102927 12:5901097-5901119 CTGCAGCGGTGGCTGCAAGAGGG + Intronic
1092135758 12:6145894-6145916 CTGCAGCTGAGGAGTGGAGATGG - Intergenic
1093084727 12:14854127-14854149 TGGCAGCTGAGGAGGGAAGATGG - Intronic
1094432949 12:30389732-30389754 CTACAGCTGAGGAGAGGAGATGG - Intergenic
1094487058 12:30933703-30933725 CTGCAGCTGTGGACCTAGGAGGG + Intronic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1095897942 12:47299661-47299683 CTGCAGCAGTGATGGGGAGAGGG - Intergenic
1096098283 12:48952210-48952232 CCACAGCTGTGAAGTGAAGAAGG + Intronic
1096745657 12:53725309-53725331 CTGGAGCTGTGGGGGGAAGGAGG - Intronic
1096758391 12:53818862-53818884 GTCCAGCTGTGGAGGGAGGATGG - Intergenic
1096778271 12:53976946-53976968 CAGGAGCTGTGGAGAGGAGAGGG - Exonic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1100479181 12:94961355-94961377 CTTCAACTGTGAAGGGGAGAGGG + Intronic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101444952 12:104730982-104731004 CTGCAGCAGTCCAGGGCAGAAGG - Intronic
1102024153 12:109703979-109704001 CTGGAGCTGCAGTGGGAAGATGG - Intergenic
1102260138 12:111438394-111438416 CTCCAGCTGGCCAGGGAAGAGGG - Intronic
1102492994 12:113299969-113299991 CTCCAGCTGTGGAAGAATGAGGG + Exonic
1102571911 12:113831893-113831915 CTGCAGCAGTGCAGGGAGGCTGG - Intronic
1102861826 12:116342660-116342682 AAGCTGCTGTGGATGGAAGAAGG + Intergenic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1104666902 12:130653902-130653924 CTGAAGCTGTGCAGGGCAGCGGG + Intronic
1104742267 12:131186928-131186950 CGGAAGCTGGGGAGGGTAGAGGG + Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105024176 12:132837768-132837790 CTGCAGCCGTGTAGAGAAGCCGG - Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105324248 13:19355750-19355772 GGGCAGCTGTGGTGGGAGGAAGG - Intergenic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1105869016 13:24487654-24487676 GGGCAGCTGTGGTGGGAGGAAGG + Intronic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1107461836 13:40611730-40611752 CTGTAGCTGTGATGGGAGGAGGG - Intronic
1107838932 13:44435857-44435879 CGGCAGCCGTGGAGGGAGAAAGG - Intronic
1108018339 13:46098840-46098862 CAGCATCTGTGGAGGAATGAAGG - Intronic
1108610958 13:52083466-52083488 CTGAAGCTGTGGCGGGGAAAAGG - Intronic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1112227664 13:97555904-97555926 CTGCAGGTGTGGATGGATGGTGG + Intergenic
1112319244 13:98392110-98392132 CTGCCTCTGGGGAGGGGAGAAGG - Intronic
1113720869 13:112555239-112555261 CTGCAGCTGTGGACAGAGGCTGG + Intronic
1114258965 14:21024331-21024353 GTGCTGATGTGGAGGTAAGAGGG + Exonic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115246467 14:31300766-31300788 CAACATCTGTGAAGGGAAGAGGG - Intronic
1116659576 14:47692045-47692067 ATGCAGCAAGGGAGGGAAGAAGG - Intergenic
1116786363 14:49293315-49293337 AGGCAGCTGAGGAGGGAACATGG - Intergenic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117162811 14:53005891-53005913 TTGCTCCTGTGGAGGGCAGAAGG - Intergenic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1118723637 14:68611141-68611163 GTGCATCTGTGGAGGGCACATGG - Intronic
1118835245 14:69473351-69473373 CTGCAGCTGGGGCGGGGAGAGGG - Intergenic
1119182532 14:72614462-72614484 CAGTAGCTGGGAAGGGAAGAGGG - Intergenic
1119401505 14:74365653-74365675 CTGCAGCGGGGGAGGGAGGCAGG - Intergenic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1119741695 14:77017913-77017935 CTTTAGCTGTGGAGGAGAGATGG + Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121231890 14:92364506-92364528 CAGCAGCTATGCAGGGCAGAGGG + Intronic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1121610352 14:95274486-95274508 CTGCAGCTGTGCTGGGCAGAGGG - Intronic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1122255332 14:100472130-100472152 CTGCAGCTGTAGAGGCATGCAGG + Intronic
1122855127 14:104556452-104556474 CTGCACCCCTGGAGGGACGAGGG + Intronic
1123118579 14:105906132-105906154 CTTCTGCTGGGGAAGGAAGAGGG - Intergenic
1123699094 15:22901567-22901589 CTGCAGCTCTGGAAAGAAGCTGG - Intronic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1125381699 15:39092884-39092906 GTGCAGCGGTGGTGGGGAGAGGG + Intergenic
1125713660 15:41806523-41806545 CTGGACCTGTGTAGGGAAGGGGG + Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127478242 15:59354848-59354870 GGGTAGCTGTGGAGGGAAGCTGG - Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1128096528 15:64960541-64960563 CAACATCTGTGAAGGGAAGATGG - Intergenic
1128632182 15:69278734-69278756 GTCCAGCTGTGGATGGCAGAAGG + Intergenic
1129227614 15:74179147-74179169 CTCCAGGTGTGGAGGTAGGAAGG - Intergenic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1129606603 15:77028169-77028191 CTCCAGGGGTGGAGGGAGGAGGG + Intronic
1129683316 15:77670774-77670796 CTGCTGCTGGGCAGGGAAGATGG + Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1131261664 15:90890977-90890999 CTGCAGCGGTGGAGGGAGCTGGG - Exonic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132281186 15:100617357-100617379 CTGCAGCTGGAAAGGTAAGAGGG - Intronic
1132450732 15:101966906-101966928 CTGCATCTGTTCAGGGGAGATGG + Intergenic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1133983890 16:10653261-10653283 CTGGAACTCTGGTGGGAAGAGGG + Intronic
1134194307 16:12147248-12147270 ATGCAGCTGTTAAGGGAAAAGGG + Intronic
1135983117 16:27164018-27164040 CTGCAGCAGGGAAGGGAAGTAGG + Intergenic
1136316885 16:29459773-29459795 CTGGAGCTGTGGTGGTAAGGAGG + Intergenic
1136431460 16:30199115-30199137 CTGGAGCTGTGGTGGTAAGGAGG + Intronic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138459136 16:57137813-57137835 CTGCAGCTGGGGGCGGGAGAAGG - Intronic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1138489846 16:57370399-57370421 CTGGACCTGGGGAGGGTAGAGGG + Intergenic
1138659306 16:58508247-58508269 GTGCTGCTGGGGAGGGAAGAGGG - Intronic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139188662 16:64836616-64836638 CTGCAACTGTGAATGGAAGGAGG - Intergenic
1139344762 16:66295862-66295884 CTGCAGCCTTGCAGAGAAGAGGG + Intergenic
1139651874 16:68366255-68366277 CTGCAGCAGTGAAGGAAGGACGG - Intronic
1140945955 16:79768676-79768698 CTCCTGCTGCGAAGGGAAGAAGG + Intergenic
1140962268 16:79927696-79927718 CTGCAGAGGTGTAGGCAAGAGGG - Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1142135392 16:88449697-88449719 CAGCAGCTGTGGATGGGTGAGGG - Intergenic
1142666905 17:1468491-1468513 CTGCAGCTGAGGAGACAAGGGGG + Exonic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143119879 17:4599931-4599953 CTCCAGCTGTGGAGGGGGCAGGG + Intronic
1143577045 17:7799973-7799995 CAGCAGCTGGGGAGGGAATGGGG - Intronic
1143870789 17:9956192-9956214 CTGCAGCAGAGAAGGGAAAATGG + Intronic
1144338659 17:14295684-14295706 CTGCACCTGTAGAAGGAAGGAGG + Intergenic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1144526462 17:15994545-15994567 CTAAAGCTGTGGAGGGAACTGGG - Intronic
1144583170 17:16471496-16471518 CTGCAGCTGTGGAAGAAGGGAGG - Intronic
1144785950 17:17831701-17831723 TTGCAGCTGTCGGGGGAGGATGG - Intronic
1144996015 17:19269293-19269315 CTCCAGCAGAGGAGGAAAGAGGG + Intronic
1146006644 17:29164662-29164684 CCACAGCTGGGAAGGGAAGATGG + Intronic
1146565649 17:33910735-33910757 CTGCCTCTCTGGAGGGAAGTAGG + Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1147427277 17:40351893-40351915 TCACAGCTGTGGAGGGCAGAGGG - Exonic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148190052 17:45672125-45672147 CTGGAGCTGGGGTTGGAAGAGGG - Intergenic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148936391 17:51166968-51166990 CTGCAGCGGGGAAGGGGAGACGG - Intronic
1149438827 17:56657512-56657534 ATGAAGCTGTGAGGGGAAGAAGG + Intergenic
1149531810 17:57401759-57401781 CGGCAGCTGGGGAGGGATGTGGG + Intronic
1150578974 17:66454986-66455008 AGGCAGCAGTGGAGGGAAGGTGG + Intronic
1150781585 17:68127399-68127421 TTGCAGTTGTGGAAGGCAGAAGG + Intergenic
1150821186 17:68435742-68435764 ATGCTGCGGAGGAGGGAAGATGG + Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151493425 17:74445786-74445808 CACCAGCTGTGGGGTGAAGAGGG - Intronic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151568791 17:74915779-74915801 CTGCAGCTACGGAGGGCAGGAGG - Intergenic
1151974476 17:77476533-77476555 CTGCAACTCTGGAGAAAAGATGG + Intronic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1153618348 18:6954037-6954059 CATCAGCTGGGGTGGGAAGAGGG + Intronic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1155294487 18:24372538-24372560 CTGCTGCTGTTGAGTGAGGAGGG - Intronic
1155398699 18:25415358-25415380 CAGCACCTGTGGAAGGAAGGAGG - Intergenic
1155499518 18:26472844-26472866 CTGCAGCTGCTGTGGGAAGCTGG + Intronic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156778470 18:40821947-40821969 CTGGAGCTGGGGAGGCAGGATGG + Intergenic
1156987964 18:43371505-43371527 TAGCAGCTGTGGCTGGAAGATGG - Intergenic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1158876085 18:61735874-61735896 GTGCAGCTTGGGAGGGAGGAGGG - Intergenic
1159817811 18:73098704-73098726 GAGCAGTTGTGGAGGGAAGCTGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160634530 19:65641-65663 CTGCATCTGTTCAGGGGAGATGG - Intergenic
1160799757 19:962327-962349 CTGCTGCTGCTGAGGGGAGAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161878186 19:6928128-6928150 CAGCAGCTGTGGAGAGAAATAGG - Exonic
1162326389 19:10002233-10002255 CTGCAGCTGTCCAGGCCAGAAGG - Intronic
1163171919 19:15537344-15537366 TGGCAGCTGTGGAGGGCAAAGGG - Exonic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163577935 19:18121668-18121690 CGGCAGCTGTGGGGGGAAAAGGG - Exonic
1163642385 19:18469071-18469093 GTGCAGCTGTGGCGGGGAGTAGG + Intronic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1164816025 19:31204137-31204159 CTCCACATGTGGAGGGAAGGAGG - Intergenic
1165246256 19:34500138-34500160 CTGCAGCTGAGCGGGGAGGAGGG + Exonic
1165285656 19:34839402-34839424 AGGGAGCTGGGGAGGGAAGAGGG + Intergenic
1165329216 19:35132037-35132059 ATGAAGCTGTGGAGGGAAGCTGG + Exonic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
1166441672 19:42820971-42820993 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166449806 19:42888959-42888981 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166461111 19:42989257-42989279 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166501059 19:43341549-43341571 CTGCAGCTAGAAAGGGAAGAAGG + Intergenic
1166509041 19:43391903-43391925 CTGCAGCTAGAAAGGGAAGAAGG - Intergenic
1167240549 19:48340717-48340739 CTGCAACCATGGAGGGCAGAGGG - Intronic
1167443593 19:49524579-49524601 TTGCAGCTCCGGAGGGTAGAAGG - Exonic
1167685215 19:50951686-50951708 CTGCACCTGTGGAGGCAACATGG - Intronic
925293887 2:2765503-2765525 CTGTATCTGTGGGGAGAAGAGGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
925451093 2:3969704-3969726 CTGCATCTGTGGGGGGCAGCAGG - Intergenic
927358041 2:22196599-22196621 CTGCAGATTTGGAGGGATGGTGG - Intergenic
927446382 2:23165707-23165729 TTGCAACTGAGGTGGGAAGATGG - Intergenic
927637569 2:24827367-24827389 CTGCAGCAGTGCAGTGAGGAGGG - Intronic
927888004 2:26730360-26730382 TTGCAGGTGTGGTGGGCAGAGGG - Exonic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928395411 2:30939811-30939833 CTCCAGCTGCGAAGGGGAGATGG - Intronic
929226438 2:39515960-39515982 CTGCAGCTGTTGGGGCAAAAGGG + Intergenic
930439803 2:51391279-51391301 CTGCTGCTGGGAAGGGAGGAGGG + Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
931883104 2:66587505-66587527 CTGGAGCTATGGAAGGAATAAGG + Intergenic
931894584 2:66714751-66714773 CTGTAGCTGAGGAGTCAAGATGG + Intergenic
932835385 2:75031142-75031164 ATGCTGGTGTGGAAGGAAGAGGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934893727 2:98093129-98093151 CAGCAGCTGCAGAGGCAAGAGGG + Exonic
935657975 2:105441172-105441194 CTACAGGTGTCCAGGGAAGAGGG + Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
936444691 2:112586352-112586374 CTGCAACTGTGGAGGTAAGAGGG + Exonic
936519198 2:113201236-113201258 GAGCAGCTGGGGAGGGAAGCTGG + Exonic
936566945 2:113589386-113589408 CTGCATCTGTTCAGGGGAGATGG + Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937267423 2:120625283-120625305 GTGCAGCTGAGGAGGGCAGAGGG + Intergenic
937288226 2:120766384-120766406 CCCCACCTGTGGAGGGAAGGTGG + Intronic
938369800 2:130762037-130762059 CAGCTGCTGTGGAGGAAAGCAGG - Exonic
938542963 2:132301179-132301201 AAGCAGCTGTGGTGGGAGGATGG - Intergenic
938571958 2:132569503-132569525 CAGCAGCTGTGGTGGGGAGGGGG + Intronic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
941843252 2:170109847-170109869 CTCCTGCTGGGGAGGGATGATGG + Intergenic
942077198 2:172366931-172366953 CTGCAGCTATGCCAGGAAGAGGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
943809904 2:192171966-192171988 AAGTAGCTGAGGAGGGAAGAAGG - Intronic
944714018 2:202361114-202361136 CTGAAGCTTTGTAGGGGAGAGGG - Intergenic
947752999 2:232542454-232542476 CTGCAGCTGAGTCAGGAAGATGG + Exonic
948041647 2:234905999-234906021 CTGCTGCTAGGGAGGGAAGCAGG - Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948716038 2:239864486-239864508 CTGCAGCTATGGAGGGTAGGGGG + Intergenic
948967096 2:241391330-241391352 CTGCAAATGTGCTGGGAAGATGG + Intronic
1168789169 20:564376-564398 ATGCTGCTGTGGAGGAAGGAGGG + Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169015969 20:2293014-2293036 GAGGAGCTGTGGAGGGTAGAAGG + Intergenic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169523693 20:6400477-6400499 CTGCAGCTGTGGTAGGTAGATGG + Intergenic
1171427798 20:25059122-25059144 TTGCAGCTGTGGAGCCAGGAAGG + Intergenic
1171871841 20:30534008-30534030 AAGCAGCTGTGGTGGGAGGATGG - Intergenic
1171964062 20:31515989-31516011 CTGCTCCTGGGGAAGGAAGATGG - Intronic
1172055313 20:32150605-32150627 CTACAACTGTGGAGGGAGGGAGG - Exonic
1172448328 20:35004565-35004587 CGGCAACTGTGGAGGGAGGCAGG + Exonic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174503743 20:51003815-51003837 CTGCAGCCGTGAAAGGAAGCTGG - Exonic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174619028 20:51859892-51859914 CTGCAGCTGTCCAGGGAAATGGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175732823 20:61365609-61365631 ATGCAGCTGGCGAGGGAAGCTGG + Intronic
1175929632 20:62487631-62487653 CTGCACCGGGGGAGGGTAGATGG + Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1177012863 21:15750088-15750110 CAGCATCCGGGGAGGGAAGAGGG + Intronic
1178019552 21:28393824-28393846 CTGCAGCTGTGCTGTGAGGATGG + Intergenic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179107517 21:38416272-38416294 CTGCAACTGTGGCAGGAAGACGG + Intronic
1179515933 21:41906916-41906938 CTGCAGTTGTGGGGGCAAGGTGG + Intronic
1179799530 21:43804484-43804506 CAGCAGGTGTGAAGGGGAGAGGG - Exonic
1180613856 22:17114800-17114822 GTGCAGATGTGGGAGGAAGAAGG + Exonic
1180619631 22:17152420-17152442 ATACAGGGGTGGAGGGAAGAGGG + Intronic
1180818769 22:18810425-18810447 ATGGATCTGTGGGGGGAAGAAGG + Intergenic
1180998562 22:19977421-19977443 CAGCTGCTTTGGAGGCAAGAAGG - Exonic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181204993 22:21244880-21244902 ATGGATCTGTGGGGGGAAGAAGG + Intergenic
1181594196 22:23903787-23903809 AAGAAGCTGTGGCGGGAAGATGG - Intergenic
1181624270 22:24112768-24112790 CTGCAGCTGGGGAAGGGAAAAGG - Intronic
1181725460 22:24807789-24807811 CTGCCACTGTGCAGGGAAGGAGG - Intronic
1181888177 22:26038132-26038154 CTCCAGCTGTGGAAGGCAGCAGG - Intergenic
1183513282 22:38248386-38248408 CTGCAGCTGAGGATGGAAGTGGG - Intronic
1183673573 22:39287495-39287517 CTGGAGCTGTGGAGGCAGCATGG - Intergenic
1183759741 22:39805265-39805287 CTTCAGCTGTGAGGTGAAGAGGG - Intronic
1184510446 22:44930242-44930264 CTGCCCCTGTGGAGGGGAGAGGG + Intronic
1184515617 22:44960264-44960286 AGGTAGCTGTGGAGGGAAGGGGG - Intronic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185090849 22:48772332-48772354 CTGCAGCTGGCGAGGGAGGGGGG + Intronic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
1203221932 22_KI270731v1_random:50535-50557 ATGGATCTGTGGGGGGAAGAAGG - Intergenic
1203268897 22_KI270734v1_random:36278-36300 ATGGATCTGTGGGGGGAAGAAGG + Intergenic
949543739 3:5054471-5054493 CTGGAGCTGAGGTAGGAAGAGGG - Intergenic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
950601930 3:14042515-14042537 TTGCAGCTGGAGGGGGAAGACGG + Intronic
950801508 3:15555351-15555373 CTGCAAATATGGAGGGACGAGGG + Intergenic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951310382 3:21117859-21117881 CTGCTGCAGGGGTGGGAAGATGG + Intergenic
952629249 3:35444776-35444798 CTGCAGCTCTGGAGGTAGGTTGG + Intergenic
954632428 3:52054911-52054933 CTACAGCTGGGGAGGGTAGTGGG + Intronic
954641876 3:52105470-52105492 CTGCCCCTGGGGAGGGAAGCAGG + Intronic
954928716 3:54261290-54261312 CACCAGATGTGGAGAGAAGACGG - Intronic
955216670 3:56989829-56989851 TTGCAGCTGTGAAGTGATGAAGG - Intronic
955364341 3:58298593-58298615 CTGCAGCAGGGGGTGGAAGAAGG + Intergenic
955838178 3:63081272-63081294 CTGCAGCTTTGGAGGAATGTGGG + Intergenic
955959272 3:64322287-64322309 GGGCAGCTGTAGAGGGAAAATGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959049606 3:101512622-101512644 CTGCTGCTGGGGAGGAAAGGTGG - Intronic
960167323 3:114418098-114418120 CATCAGCTGTGAAAGGAAGAAGG + Intronic
960639550 3:119812803-119812825 CTGCAGCTGCGGGGGGAGGATGG + Exonic
961483543 3:127199891-127199913 CCTCAGCTGGGGAGGGGAGAGGG + Intergenic
961542741 3:127611129-127611151 CTGCAGGTGGTGAGGGTAGAAGG - Intronic
961630564 3:128295628-128295650 CTGGAACTGTGGTGAGAAGATGG + Intronic
961861277 3:129918456-129918478 CAACAGCTGTGGAGAGAAGCCGG + Intergenic
961861281 3:129918480-129918502 CGACAGCTGTGGAGAGAAGCCGG + Intergenic
963942682 3:151110858-151110880 CTGCTGCTGTTGAGCCAAGATGG + Intronic
964142851 3:153422916-153422938 ATGGAACTTTGGAGGGAAGAAGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964374556 3:156036141-156036163 CTGCATCTGGGGGGTGAAGAAGG + Intergenic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
964758773 3:160114186-160114208 CTGCTGCTGTGGAGTGGGGAGGG - Intergenic
964899431 3:161640322-161640344 TTGCAGCTGAGGAAGGAAAAGGG - Intergenic
965087137 3:164113719-164113741 CTGCAGCTGTTCAGGGAATGAGG - Intergenic
965283624 3:166786680-166786702 ATGCATATGTGGGGGGAAGAGGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965825899 3:172729505-172729527 CGGAAGCATTGGAGGGAAGAAGG + Intergenic
966417470 3:179704464-179704486 TGGCTGCTGTGCAGGGAAGAGGG - Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967649940 3:191973744-191973766 CTGCAGCTGCTAAGGAAAGAGGG + Intergenic
968234706 3:197024732-197024754 CAGCTGCTGGGGAAGGAAGAGGG - Intronic
969425064 4:7119449-7119471 CTGCAGCCCTGGGAGGAAGAGGG - Intergenic
969426608 4:7128111-7128133 CTGCAGCAAGGGAGGAAAGAGGG + Intergenic
969506664 4:7592219-7592241 CAGCAGCTGTGGATGAAAGTGGG - Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
971310971 4:25525504-25525526 CTGGAGCTGAGGAGGAGAGAGGG - Intergenic
971400160 4:26268751-26268773 CTGCAGCAGAGGCGGGAGGAAGG + Intronic
971743228 4:30546630-30546652 CGCCACCTGTGGAGGGAAGGGGG - Intergenic
971991681 4:33906053-33906075 ATGAAGCTGTGGAGGAAAAAGGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
974941720 4:68477516-68477538 CTGCATTTGTGTAGGGAACAGGG - Exonic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
978194350 4:105953578-105953600 CTGCATCTGTAGAGAGAATAGGG + Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
978929796 4:114296366-114296388 CAGCAGCTGTGGAGGGTATGCGG - Intergenic
980190175 4:129514984-129515006 CTGCAGCTAAAGATGGAAGATGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981514981 4:145597703-145597725 ATGCAGCTGTGAAGGGATTAAGG + Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982972958 4:162014102-162014124 CTGCATCTGTGGAGGCAAGTGGG + Intronic
983045340 4:162980245-162980267 CTACCTCTGAGGAGGGAAGAGGG - Intergenic
983199595 4:164846584-164846606 CTGCAGCTGTGGTGTGAAGTGGG - Intergenic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
983729800 4:170979068-170979090 CTGCTTCTGTGGAGGTAACAGGG + Intergenic
984373343 4:178894652-178894674 CAGCACCGGTGGAGGGAAGGAGG + Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
987024627 5:13912031-13912053 CTGCAGCTTTGCAGGGCAGTAGG - Intronic
987537346 5:19206360-19206382 CTCCACCTGAGGAGAGAAGAAGG + Intergenic
988905160 5:35780464-35780486 CTTCAGCTGTGGAGGGACGGAGG + Intronic
989199814 5:38752038-38752060 CTACCTCTGAGGAGGGAAGAGGG + Intergenic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
990210579 5:53479146-53479168 TTGCAGTTGTGGAGGGGGGAAGG + Intergenic
990416995 5:55596311-55596333 CTGCATGTGGGGAGGAAAGATGG + Intergenic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
992774425 5:80077175-80077197 CTGCAGCTATGCAGAGAAGCTGG - Intronic
992837488 5:80654933-80654955 CGGCAGCTGGGGCGGGAAGGCGG - Exonic
993453810 5:88104459-88104481 ATGAAGCTGTGAAGGAAAGAAGG + Intergenic
996220507 5:120926671-120926693 CTGCAGCTGAAGAGAGAAGTAGG - Intergenic
996883927 5:128333325-128333347 CTGAATCTGGGCAGGGAAGAAGG - Intronic
997656355 5:135557653-135557675 CTGCTGCAGTGGAGAGAGGATGG + Intergenic
998031342 5:138871546-138871568 CTGCTGCTGAAAAGGGAAGAGGG - Exonic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
998354795 5:141526021-141526043 ATGCAGGTGAGGAGTGAAGACGG - Exonic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999188490 5:149730324-149730346 CTGCAGCCGCGGCTGGAAGATGG + Exonic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999444894 5:151631419-151631441 CAGCAGCTGTTGAGGTAACAGGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001657495 5:173363233-173363255 CTGGAGCTTTGGAGGGAGCATGG + Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1001804443 5:174571211-174571233 CTGCAACTATCCAGGGAAGAAGG - Intergenic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002887454 6:1310168-1310190 CTGCAGCTGGGGAGGGGAGGAGG + Intergenic
1003324373 6:5081584-5081606 CTAAAGCTGAGAAGGGAAGAGGG - Intergenic
1003520831 6:6857080-6857102 GTACAGCTGTGGAGGAAAGCAGG + Intergenic
1003560500 6:7176020-7176042 CTGGAGCTGAGGTGGGAGGATGG - Intronic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004044735 6:12012595-12012617 CTGCAGCTGGGGAGGGCGGCGGG + Intronic
1004135621 6:12963295-12963317 GTGCAGCTGTGGAGGGGAAGAGG - Intronic
1004311603 6:14551020-14551042 CTGCAGCTGTGGAGTCCCGAGGG - Intergenic
1006897612 6:37480934-37480956 CTGCTGCTGTGGGGGAAAGACGG - Exonic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007630043 6:43268417-43268439 CTCCAGCAGAGTAGGGAAGAGGG - Intronic
1008069617 6:47086177-47086199 CAACAGCTGTGGAGGCATGAAGG - Intergenic
1008532801 6:52480022-52480044 TTTCAGCTGTGGAGGGAGGCTGG - Intronic
1008925151 6:56884616-56884638 CTACTGCTGTTGAAGGAAGAAGG - Intronic
1009677674 6:66847079-66847101 CAGCACCTGTGAAGGAAAGAGGG - Intergenic
1010602428 6:77846674-77846696 CTCCAGCAGAGGAGTGAAGATGG - Intronic
1011325968 6:86150408-86150430 CTGAAGCTGTATAGGGAAGTTGG + Intergenic
1013115734 6:107102492-107102514 ATGCAGCTGAGGTGGGAGGAAGG + Intronic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1015899920 6:138053720-138053742 CTGCAGCAGTGGAGGTAGCAGGG - Intergenic
1015958265 6:138620946-138620968 CTGCAGCTGGGGAGGACAGATGG + Intronic
1016215226 6:141591758-141591780 ATGCAGATGGGGTGGGAAGAGGG - Intergenic
1016888309 6:148980318-148980340 CAGCAGCCGTGGAGAGAAGATGG - Intronic
1017050645 6:150390610-150390632 CAGCACCTATGGAGGGAGGAAGG - Intronic
1017230083 6:152064273-152064295 CAGCAGCTGCGGAGGAAGGATGG + Intronic
1017510783 6:155112833-155112855 CTGAAGCTCTGGAGGGCCGAAGG - Intronic
1017548571 6:155479442-155479464 CTGCACTTGTGGAGGGAGGGAGG + Intergenic
1017791328 6:157802181-157802203 TAGCAGCTGCGGAGGGCAGAGGG - Intronic
1017945175 6:159090761-159090783 CTGCAGCTGAGGCGGTAAGACGG - Intergenic
1017989195 6:159471377-159471399 CTGCAGCAGTGCAGGGCAGTGGG + Intergenic
1018596614 6:165487860-165487882 CTGCAAGTGTGCAGGGAAAAGGG - Intronic
1018650034 6:165985848-165985870 TTGAAGCTGTGTGGGGAAGAAGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019625320 7:2012946-2012968 CAGCAGCTGTTCAGGGAAGATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019772866 7:2894813-2894835 CTGCAGCTGCGCCGGGAAGCAGG - Intergenic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1021673563 7:23057821-23057843 CTGGATCTGGGAAGGGAAGAAGG - Intergenic
1022159532 7:27695297-27695319 ATGATGCTGTGGAGGGCAGAGGG - Intergenic
1022248803 7:28586478-28586500 CTTCAGCTGGAGAGGGAAGGGGG - Intronic
1023003220 7:35834046-35834068 CTGCTGCTGTGGAGTAGAGATGG + Intronic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024634602 7:51276687-51276709 CTGCAGCTGTGTGGGGCAAAGGG + Intronic
1024715086 7:52069857-52069879 CTGCATCTGTGAAGGGACCAGGG - Intergenic
1024921051 7:54554780-54554802 CTGGAGCTGTGGCTGGAGGAAGG - Intronic
1025807550 7:64849613-64849635 CTGCAGCTGCAGTGGGAAGTGGG + Intergenic
1026601727 7:71783104-71783126 AATCAGGTGTGGAGGGAAGATGG + Exonic
1026731436 7:72914998-72915020 CTCCACCTCTGCAGGGAAGAGGG + Intronic
1026792439 7:73342984-73343006 CTGCAGCTGAGGGTGGACGAGGG + Intronic
1026849658 7:73717010-73717032 CTGCAGATGGGGAGTGAAGGGGG - Intronic
1027890500 7:83967355-83967377 CTGGAGCTGGGGAGAGAAGGGGG - Intronic
1029327539 7:99823103-99823125 CTGCAGCTGTGCAGGGTAGGGGG - Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1030674515 7:112370554-112370576 CAACACCTGTGAAGGGAAGAAGG + Intergenic
1032853423 7:135814539-135814561 CTGCGGCTGTGAAAGCAAGAGGG - Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033346264 7:140527496-140527518 CTGCAGCCGGGGAGAGAACAGGG + Intronic
1033810152 7:145002368-145002390 AAGCATCTGTGGTGGGAAGATGG + Intergenic
1034317572 7:150147738-150147760 CTGCAGCTGTGGTTGAACGAGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034775185 7:153819487-153819509 CTGCAGCTGTGGTTGAACGAGGG + Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035789944 8:2295713-2295735 CTCCACCTGTGGAGGGGACACGG - Intergenic
1035802861 8:2425992-2426014 CTCCACCTGTGGAGGGGACACGG + Intergenic
1036188512 8:6647745-6647767 CTGCAGCTGGGGATGGGAGTGGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1036930573 8:12951841-12951863 CTGCGGCCGCGGCGGGAAGAAGG + Intronic
1037339748 8:17831865-17831887 GGGCAGCGGTGGAGGGAAGGTGG - Intergenic
1037458622 8:19086916-19086938 CTGTACCTGAGGAGGAAAGAAGG + Intergenic
1037915386 8:22769859-22769881 CTGCAGCAATGGCGGGAGGAAGG - Intronic
1038156900 8:24999971-24999993 CTGCACCAGTTCAGGGAAGAGGG - Intergenic
1038473424 8:27844351-27844373 CTGCAGCTGTGGAGCAAGGTGGG + Intergenic
1039924346 8:41915736-41915758 TTGCAGGTTTGGGGGGAAGATGG - Intergenic
1040596262 8:48840444-48840466 CTCCAGCTGTAAAGGCAAGAAGG - Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1041014011 8:53572649-53572671 ATGCAGCTGTGAAAGGAAGGAGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042837063 8:73088567-73088589 CGGGAGCTGAGGTGGGAAGATGG + Intronic
1043635051 8:82375011-82375033 AAGCAGGTGTGGAGGGAGGAAGG + Intergenic
1043912649 8:85880954-85880976 CTAAAGCTCTGTAGGGAAGATGG + Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044771582 8:95641194-95641216 CCACAGCTGTGGAGGGCAGAGGG - Intergenic
1045488829 8:102654775-102654797 CAGCAGCTGGGGCGGGAAGGTGG - Intronic
1045817746 8:106296455-106296477 TTGTAACTGTGGAAGGAAGATGG + Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047906032 8:129474159-129474181 CTGCAGGTGTGGGGGGCAGCAGG + Intergenic
1048690867 8:136961662-136961684 CATCAGCTGTGAATGGAAGAGGG - Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049592062 8:143467086-143467108 CTGCAGCCGCAGAGGGGAGAGGG + Intronic
1049592612 8:143469410-143469432 CTGCAGCTGTGGAGGTCTGGGGG + Intronic
1049885584 9:24146-24168 CTGCATCTGTTCAGGGGAGATGG - Intergenic
1050301559 9:4264016-4264038 CTGGAGCTCTGGAGTGAAGTGGG - Intronic
1052409311 9:28102574-28102596 CTGCAGCTGGGAAGGGAAAGGGG + Intronic
1052739751 9:32382165-32382187 CCCCACCTGTGGAGGGAAGGAGG + Intergenic
1052739778 9:32382333-32382355 TAGCAGGTGTGGTGGGAAGAGGG + Intergenic
1053124601 9:35569852-35569874 AGGCAGCTGGGGAGGGAGGAGGG + Intergenic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056068517 9:82961752-82961774 CGGCAGCTGTGGAGATAATAGGG + Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056981999 9:91322426-91322448 CTGAAGCTGGGGAGAGAAGCAGG + Intronic
1057270447 9:93647364-93647386 GGACAGCTGTGGAGGGAACACGG - Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1061044463 9:128157351-128157373 GTGCTGCAGTGGAGGGTAGAGGG - Intergenic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061246625 9:129404134-129404156 CTGCAGCAGTGGAGGGACAGAGG + Intergenic
1061251027 9:129426461-129426483 CTGCACCTGTGGAGTGAGCAAGG - Intergenic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1185967106 X:4619083-4619105 ATGCAGCTGAGGAGAAAAGAAGG + Intergenic
1186976305 X:14909270-14909292 ATTCAGCTGGGGAGGGAATATGG - Intronic
1187326416 X:18294878-18294900 CTGCTACTGTGGAGGGATTAAGG - Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1189231760 X:39457800-39457822 CTGCTGCCGGGGAGGGGAGAAGG - Intergenic
1189707184 X:43770361-43770383 TGGCAGCTGTGGAAGGGAGAAGG - Intronic
1192224931 X:69221628-69221650 CTGCAGCTCTGGGGGCAGGATGG - Intergenic
1192633474 X:72794889-72794911 CAGAAGCTGGGGAGGGAAGGGGG - Intronic
1192648235 X:72925912-72925934 CAGAAGCTGGGGAGGGAAGGGGG + Intronic
1192734889 X:73841257-73841279 TTGCAGATGAGGTGGGAAGAAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1196755191 X:119151251-119151273 ATGCTGTTGTGGCGGGAAGATGG - Intergenic
1196938448 X:120752570-120752592 CTGCAGCTGTGAGGGGTGGAGGG - Intergenic
1197359737 X:125485694-125485716 GTGCTGCTGAGGAGTGAAGATGG - Intergenic
1197572157 X:128163152-128163174 CTGCAGCTGTTGTGGGAAATGGG + Intergenic
1197899100 X:131349752-131349774 CTGCTGCTGTGGATGCAAAATGG + Intronic
1198578580 X:138037447-138037469 CTTCATCTGTGGAAAGAAGAGGG + Intergenic
1199810847 X:151347034-151347056 CTCCAGCTTTGTAGGGAAGGGGG + Intergenic
1200054767 X:153454503-153454525 CAGCAGCTGGGGAGGGAGGGAGG + Exonic
1201226467 Y:11823562-11823584 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
1201724145 Y:17135229-17135251 CTGCAGCTGTGTGGGTAAGCTGG - Intergenic