ID: 1036752834

View in Genome Browser
Species Human (GRCh38)
Location 8:11454199-11454221
Sequence TGCCAAAGCCAGGGTGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036752820_1036752834 19 Left 1036752820 8:11454157-11454179 CCTTCTTGACCCCGACACCGTCT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data
1036752828_1036752834 -10 Left 1036752828 8:11454186-11454208 CCCATGGCTCTGCTGCCAAAGCC 0: 1
1: 0
2: 0
3: 26
4: 214
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data
1036752818_1036752834 28 Left 1036752818 8:11454148-11454170 CCGGCCTCACCTTCTTGACCCCG 0: 1
1: 0
2: 1
3: 17
4: 242
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data
1036752827_1036752834 2 Left 1036752827 8:11454174-11454196 CCGTCTGGGTTGCCCATGGCTCT 0: 1
1: 0
2: 1
3: 29
4: 179
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data
1036752823_1036752834 10 Left 1036752823 8:11454166-11454188 CCCCGACACCGTCTGGGTTGCCC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data
1036752819_1036752834 24 Left 1036752819 8:11454152-11454174 CCTCACCTTCTTGACCCCGACAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data
1036752825_1036752834 8 Left 1036752825 8:11454168-11454190 CCGACACCGTCTGGGTTGCCCAT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data
1036752824_1036752834 9 Left 1036752824 8:11454167-11454189 CCCGACACCGTCTGGGTTGCCCA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036752834 Original CRISPR TGCCAAAGCCAGGGTGGGCT TGG Intronic
No off target data available for this crispr