ID: 1036755078

View in Genome Browser
Species Human (GRCh38)
Location 8:11466427-11466449
Sequence GGCCGCTCATGCGCTCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036755078_1036755099 30 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755099 8:11466480-11466502 CTCCAGGGCGCTTTGGGATCGGG 0: 1
1: 0
2: 3
3: 9
4: 143
1036755078_1036755094 24 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755094 8:11466474-11466496 CGTCCCCTCCAGGGCGCTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1036755078_1036755092 15 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755092 8:11466465-11466487 GTAGGAGCGCGTCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 58
1036755078_1036755086 -7 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755086 8:11466443-11466465 AGCGGCCTCTCCCGGGGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 352
1036755078_1036755085 -10 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1036755078_1036755091 14 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755091 8:11466464-11466486 GGTAGGAGCGCGTCCCCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1036755078_1036755098 29 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755098 8:11466479-11466501 CCTCCAGGGCGCTTTGGGATCGG 0: 1
1: 0
2: 0
3: 12
4: 124
1036755078_1036755087 -3 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755087 8:11466447-11466469 GCCTCTCCCGGGGGGGCGGTAGG 0: 1
1: 0
2: 1
3: 22
4: 315
1036755078_1036755093 23 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755093 8:11466473-11466495 GCGTCCCCTCCAGGGCGCTTTGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036755078 Original CRISPR GGCCGCTCATGCGCTCCCGC GGG (reversed) Intronic