ID: 1036755085

View in Genome Browser
Species Human (GRCh38)
Location 8:11466440-11466462
Sequence ATGAGCGGCCTCTCCCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036755074_1036755085 9 Left 1036755074 8:11466408-11466430 CCTCTGGGAGGGCAGCGAACCCG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1036755072_1036755085 16 Left 1036755072 8:11466401-11466423 CCCGGCTCCTCTGGGAGGGCAGC No data
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1036755068_1036755085 24 Left 1036755068 8:11466393-11466415 CCTGGCTGCCCGGCTCCTCTGGG No data
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1036755078_1036755085 -10 Left 1036755078 8:11466427-11466449 CCCGCGGGAGCGCATGAGCGGCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1036755065_1036755085 29 Left 1036755065 8:11466388-11466410 CCAGCCCTGGCTGCCCGGCTCCT No data
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1036755066_1036755085 25 Left 1036755066 8:11466392-11466414 CCCTGGCTGCCCGGCTCCTCTGG No data
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1036755073_1036755085 15 Left 1036755073 8:11466402-11466424 CCGGCTCCTCTGGGAGGGCAGCG No data
Right 1036755085 8:11466440-11466462 ATGAGCGGCCTCTCCCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036755085 Original CRISPR ATGAGCGGCCTCTCCCGGGG GGG Intronic