ID: 1036755991

View in Genome Browser
Species Human (GRCh38)
Location 8:11471474-11471496
Sequence CATTGGGACGGCAATAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036755981_1036755991 3 Left 1036755981 8:11471448-11471470 CCCCCGCATGTCCCAGGTGATGA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG No data
1036755987_1036755991 -8 Left 1036755987 8:11471459-11471481 CCCAGGTGATGATGACATTGGGA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG No data
1036755983_1036755991 1 Left 1036755983 8:11471450-11471472 CCCGCATGTCCCAGGTGATGATG 0: 1
1: 0
2: 0
3: 22
4: 177
Right 1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG No data
1036755984_1036755991 0 Left 1036755984 8:11471451-11471473 CCGCATGTCCCAGGTGATGATGA 0: 1
1: 0
2: 0
3: 8
4: 195
Right 1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG No data
1036755982_1036755991 2 Left 1036755982 8:11471449-11471471 CCCCGCATGTCCCAGGTGATGAT 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG No data
1036755980_1036755991 4 Left 1036755980 8:11471447-11471469 CCCCCCGCATGTCCCAGGTGATG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG No data
1036755988_1036755991 -9 Left 1036755988 8:11471460-11471482 CCAGGTGATGATGACATTGGGAC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036755991 Original CRISPR CATTGGGACGGCAATAGAGG TGG Intronic
No off target data available for this crispr