ID: 1036757115

View in Genome Browser
Species Human (GRCh38)
Location 8:11477895-11477917
Sequence TATGAAGCAGCAGCCGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036757109_1036757115 19 Left 1036757109 8:11477853-11477875 CCAGGACACAGTTAAGTCCTCTG No data
Right 1036757115 8:11477895-11477917 TATGAAGCAGCAGCCGTGGCTGG No data
1036757110_1036757115 2 Left 1036757110 8:11477870-11477892 CCTCTGTTTTCTCCAGAGTCCGC No data
Right 1036757115 8:11477895-11477917 TATGAAGCAGCAGCCGTGGCTGG No data
1036757108_1036757115 20 Left 1036757108 8:11477852-11477874 CCCAGGACACAGTTAAGTCCTCT No data
Right 1036757115 8:11477895-11477917 TATGAAGCAGCAGCCGTGGCTGG No data
1036757111_1036757115 -10 Left 1036757111 8:11477882-11477904 CCAGAGTCCGCCATATGAAGCAG No data
Right 1036757115 8:11477895-11477917 TATGAAGCAGCAGCCGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036757115 Original CRISPR TATGAAGCAGCAGCCGTGGC TGG Intergenic
No off target data available for this crispr