ID: 1036758338

View in Genome Browser
Species Human (GRCh38)
Location 8:11486692-11486714
Sequence TGCCTTGTGCCTTCACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036758338_1036758342 6 Left 1036758338 8:11486692-11486714 CCTTTATGTGAAGGCACAAGGCA No data
Right 1036758342 8:11486721-11486743 AAAGGTGCACCAAAAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036758338 Original CRISPR TGCCTTGTGCCTTCACATAA AGG (reversed) Intergenic
No off target data available for this crispr