ID: 1036758459

View in Genome Browser
Species Human (GRCh38)
Location 8:11488787-11488809
Sequence TTTTCCTTAGTAGTTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036758458_1036758459 26 Left 1036758458 8:11488738-11488760 CCATTTAAATTCTTCTGTTTATT No data
Right 1036758459 8:11488787-11488809 TTTTCCTTAGTAGTTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036758459 Original CRISPR TTTTCCTTAGTAGTTGCTGC AGG Intergenic
No off target data available for this crispr