ID: 1036758987

View in Genome Browser
Species Human (GRCh38)
Location 8:11494007-11494029
Sequence TGGTGCACACAGATGGCACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036758982_1036758987 4 Left 1036758982 8:11493980-11494002 CCAGTGAGGCTGAAAGAACGGCT 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG 0: 1
1: 1
2: 1
3: 28
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036758987 Original CRISPR TGGTGCACACAGATGGCACA TGG Exonic
900323287 1:2095442-2095464 TGGTGCCCACCGAGGGCCCAGGG + Intronic
900946642 1:5834633-5834655 TGGTGCCCACAGAGGGCTCGGGG - Intergenic
901057005 1:6453195-6453217 TGGGGCACATAAATGGCACTCGG - Intronic
901181212 1:7342960-7342982 TGGTGCCCACTGATTGCAGAGGG - Intronic
902477371 1:16695296-16695318 TGGGGCACATAAATGGCACTCGG + Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905490880 1:38342902-38342924 AGTGGCACACAAATGGCACATGG + Intergenic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
907363659 1:53943043-53943065 TGGTGCTCACAAATGGAAAAAGG + Intronic
916321290 1:163507352-163507374 TGGTGCTTGAAGATGGCACAAGG - Intergenic
916557187 1:165903438-165903460 TGGAGAACACAGAGGACACAAGG - Intronic
920224401 1:204427744-204427766 TTGTCCCTACAGATGGCACATGG - Exonic
920730671 1:208480928-208480950 AGGTGCAGACCGATAGCACAAGG + Intergenic
1063993665 10:11595248-11595270 TGAGGCACACTGAAGGCACAAGG + Intronic
1064182585 10:13131408-13131430 TGGTGACCACACATGGGACATGG + Intronic
1064261120 10:13787377-13787399 TGGTGCACACCGGTGGCACCAGG + Intronic
1064428817 10:15254148-15254170 GGGTGGACACAGATGGCAGAGGG + Intronic
1065163796 10:22953136-22953158 TGGTGGACACAGAGGTCAGAAGG + Intronic
1070552174 10:77498476-77498498 AGATGCAAACAGTTGGCACAAGG + Intronic
1072896487 10:99371869-99371891 TGGAGAACAGAGATGGCCCACGG + Intronic
1073320360 10:102612719-102612741 CGGTGGTCAAAGATGGCACAGGG + Intronic
1073384625 10:103114510-103114532 AGGTGCACACTGTTGGCCCATGG - Intronic
1075568411 10:123521002-123521024 TGGTGCACGGAGACAGCACACGG - Intergenic
1076493115 10:130877228-130877250 CGGTTCACACAAATGGCTCATGG + Intergenic
1076549870 10:131271429-131271451 AGGTGCCCACAGAAGGCACGTGG + Intronic
1076835250 10:133017678-133017700 TGGTAGACACGGATGCCACATGG + Intergenic
1076835255 10:133017706-133017728 TGGTAGACACGGATGCCACATGG + Intergenic
1076835282 10:133017845-133017867 TGGTAGACACGGATGCCACATGG + Intergenic
1076835287 10:133017873-133017895 TGGTAGACACGGATGCCACATGG + Intergenic
1076835298 10:133017929-133017951 TAATGGACACAGATGCCACATGG + Intergenic
1076835303 10:133017957-133017979 TGGTAGACACGGATGCCACATGG + Intergenic
1076835308 10:133017985-133018007 TGGTAGACACGGATGCCACATGG + Intergenic
1076835349 10:133018209-133018231 TGGTAGACACGGATGCCACATGG + Intergenic
1076835363 10:133018294-133018316 TGGTAGACACGGATGCCACATGG + Intergenic
1076835368 10:133018322-133018344 TGGTAGACACGGATGCCACATGG + Intergenic
1076835373 10:133018350-133018372 TGGTAGACACGGATGCCACATGG + Intergenic
1076835389 10:133018434-133018456 TGGTAGACACGGATGCCACATGG + Intergenic
1076835399 10:133018490-133018512 TGGTAGACACGGATGCCACATGG + Intergenic
1077104271 11:835176-835198 TGGTGCCCACAGACAGGACAGGG - Intronic
1078461767 11:11520027-11520049 GGGTGCAAACAGCTGGCACTGGG + Intronic
1078516341 11:12025970-12025992 TGGTGCACCTGGATGGCACATGG - Intergenic
1078761247 11:14253572-14253594 TGGTCCCAACAGAGGGCACAGGG + Intronic
1082812128 11:57484725-57484747 GTGTGCACACTCATGGCACATGG + Exonic
1083896902 11:65624585-65624607 TGATGCCCACAGGTGGCTCAGGG + Intronic
1090121573 11:124034801-124034823 AGGTGCACATTGAAGGCACATGG - Intergenic
1090429552 11:126634658-126634680 AGGTGCACACAGCAGGTACAAGG - Intronic
1090442210 11:126733909-126733931 TGCTTTACCCAGATGGCACAGGG + Intronic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1096601166 12:52730706-52730728 TGATGGGCACAGATGGGACAAGG + Intergenic
1097957643 12:65502607-65502629 TGGTGTAGACAGATGGCTAATGG - Intergenic
1098129924 12:67339740-67339762 TGATGCTCACATATGCCACATGG - Intergenic
1098132180 12:67362267-67362289 TGGTGCACCCAGAGAGAACATGG + Intergenic
1099530080 12:83768009-83768031 TGAGGCACACAGATGTAACAAGG - Intergenic
1102007786 12:109599515-109599537 TGGTGCACAGAGCTGGCTCAAGG + Intergenic
1102109511 12:110354223-110354245 TGCTGCATATAGATGGCAGATGG + Intergenic
1102485627 12:113253590-113253612 TGGTGCAGACAGAAGACTCAAGG - Intronic
1104457905 12:128930689-128930711 AGGGGCACACAGATAGCACTAGG + Intronic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1106845885 13:33737395-33737417 TGTTGTGCACAGATGGCCCAAGG + Intergenic
1108071378 13:46632349-46632371 TGGGGCAGACATATGGCACCAGG - Intronic
1108322243 13:49300615-49300637 TGCTGCACACTGAAGGCCCAGGG - Intergenic
1109287999 13:60434784-60434806 AGGTGTTCAAAGATGGCACATGG + Intronic
1111914905 13:94350783-94350805 TGGGGCACACAGATGGCATTAGG + Intronic
1113067553 13:106387627-106387649 TGTTGCACACAAAAAGCACAAGG + Intergenic
1113630097 13:111876424-111876446 CGGTGCACACAGAGGGCAGTGGG + Intergenic
1113933307 13:113980062-113980084 TGGTGCACACACATGGGAGGAGG - Intronic
1113933348 13:113980290-113980312 AGGTGCACATACATGGCAGAAGG - Intronic
1113933374 13:113980438-113980460 AGGTGCACACACATGGCAGGAGG - Intronic
1117969886 14:61241246-61241268 TGGTGCACCCAGAGAGGACATGG - Intronic
1120656115 14:87191875-87191897 AAGTGCACACAGCTGGCACATGG + Intergenic
1123207744 14:106729499-106729521 TGGTGCATACATAGGGCAGAGGG + Intergenic
1128308584 15:66616291-66616313 AGGACCACACAGTTGGCACAAGG - Intronic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1132073318 15:98798641-98798663 TGGTGCACACAGGATGCACGTGG + Intronic
1132497953 16:272746-272768 TGGTCCACCCAGAGGGCACTTGG - Intronic
1134112579 16:11524406-11524428 AGGTGCACACAGCTGGCTAACGG + Intergenic
1135834013 16:25806481-25806503 AAGTGCACACGGTTGGCACAGGG - Intronic
1136531444 16:30872347-30872369 TGGTGCCCACAGGTGGAATAGGG + Intronic
1136922873 16:34346187-34346209 TGAGGAACACAGATGGCACCAGG - Intergenic
1136981700 16:35065619-35065641 TGAGGAACACAGATGGCACCAGG + Intergenic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1138345225 16:56316416-56316438 GTGGGCACACAGATGGCTCAGGG - Intronic
1140808356 16:78553822-78553844 TGGTGGTCACAGCTGGCAAAGGG + Intronic
1140854503 16:78966020-78966042 TGAGGCACACAGATAGCACCTGG - Intronic
1141920374 16:87131810-87131832 GAGGGCCCACAGATGGCACACGG + Intronic
1142420603 16:89967221-89967243 TGGTGCACATGGTTGGCACACGG + Exonic
1144358224 17:14466355-14466377 TGGCGCACACACATGGCTCTTGG + Intergenic
1148552209 17:48557306-48557328 TGGTGCATCCAGATGGGAGAAGG - Intronic
1149158314 17:53660939-53660961 CGGAGCACAGAGCTGGCACAAGG + Intergenic
1149375120 17:56035988-56036010 AGGAGCACACAGATGGTAGAAGG - Intergenic
1150440074 17:65183844-65183866 GGGTGCAGACAATTGGCACAGGG - Intronic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1152276892 17:79363225-79363247 TGATGCACAGAGAGGGGACATGG + Intronic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1159278408 18:66250891-66250913 GAGTGCACACAGATGTCTCAGGG - Intergenic
1161031117 19:2058151-2058173 TGGAGCACACAGAAGGTTCAGGG + Intergenic
1163525395 19:17817918-17817940 TGGGGCACTCAGGTGGCATATGG - Intronic
1163683638 19:18697796-18697818 TGGTGTACCCAGTTGGCACTGGG + Intronic
1163817909 19:19478231-19478253 TGGGGCCCACAGATGGAAAAGGG - Intronic
1166302239 19:41917878-41917900 TCGTGCACCCAGATGGGACAGGG - Intronic
1166329846 19:42071438-42071460 TCGAACACACAGCTGGCACATGG + Intronic
1166695555 19:44849454-44849476 TGATGAACACAGAAGGGACAGGG + Intronic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1166918828 19:46214275-46214297 GCATGCACACAGATGGCACCTGG + Intergenic
1167991057 19:53361009-53361031 TGCCGCCCACAGATGTCACATGG + Intergenic
1202711389 1_KI270714v1_random:21122-21144 TGGGGCACATAAATGGCACTCGG + Intergenic
925297775 2:2789610-2789632 TGGTGCTCACAGGTGGGAAAGGG + Intergenic
925709870 2:6728318-6728340 TGGTGCACAAAGATGGCTAAAGG + Intergenic
928199920 2:29241320-29241342 TGGGGCTCAGAGAGGGCACAGGG - Intronic
931894082 2:66709707-66709729 TGGAGCACTCAGGTGGCACCTGG - Intergenic
933093136 2:78146111-78146133 TGGTGCTCAGGGATGGCCCAGGG - Intergenic
933606864 2:84392388-84392410 TGGTGTACCCAGAGAGCACATGG - Intergenic
935062612 2:99621585-99621607 TGGTGGGGACAGAAGGCACAAGG + Intronic
940052096 2:149475913-149475935 TGTTCCACACACATGTCACAAGG + Intergenic
944562576 2:200955669-200955691 AGATGCACAGAGATGACACAGGG + Intronic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
945624573 2:212186248-212186270 TGCTTAACAAAGATGGCACAAGG - Intronic
948160351 2:235818407-235818429 TGGTGAGCACAGATGGCATGGGG - Intronic
1169032442 20:2420612-2420634 TGGAGCACATAGCTGGAACATGG - Intronic
1170172582 20:13431872-13431894 AGGGGCACACTGATGTCACATGG - Intronic
1172609296 20:36237624-36237646 AGGAGCACACAGATGTCACAAGG + Intronic
1172962422 20:38807886-38807908 TGGAGAGCACAGATGGCACGGGG - Intronic
1173530963 20:43769268-43769290 AGGTGCACACAGATGGCCAGAGG - Intergenic
1174694371 20:52542560-52542582 TGGGGAACACAGTTGGCACATGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175910203 20:62401674-62401696 AGGTGCACACAGACGCCACACGG + Intronic
1178880715 21:36448002-36448024 TGGGGCACACACATGGCACATGG + Intergenic
1181022850 22:20112653-20112675 TGGAGCACCCCAATGGCACAGGG - Exonic
1181579712 22:23821237-23821259 GGGTGGACACAGCTGGCCCAGGG + Intronic
1181629465 22:24143003-24143025 TGGACCACACAGCTGGCCCAGGG - Intronic
1183091733 22:35526918-35526940 TGGTGGACAGAGCTGGAACAAGG + Intergenic
1184319812 22:43732317-43732339 TGAGGCCCACAGATGGCATATGG + Intronic
1185047406 22:48535595-48535617 TGCTGCACACACATCACACATGG + Intronic
1185047418 22:48535831-48535853 TGCTGCACACACATCACACACGG + Intronic
1185165715 22:49261120-49261142 TGATGTACAGAGATGGCAGAGGG + Intergenic
950118645 3:10467500-10467522 TGGCAGACACAGTTGGCACATGG + Intronic
950198165 3:11024031-11024053 TGCTGAACACGGAAGGCACAGGG + Intronic
951707155 3:25554823-25554845 TGGTGTCCCAAGATGGCACAGGG + Intronic
952535982 3:34309542-34309564 TGGTACACCCAGATGCCACCAGG - Intergenic
955019480 3:55105452-55105474 TGGTGCAACCAGAGGGCCCATGG + Intergenic
956057417 3:65315072-65315094 TGTTTAACACAGGTGGCACAAGG + Intergenic
958781544 3:98549415-98549437 TGGGGCACTCAGAGGACACAGGG - Intronic
959173744 3:102877278-102877300 TGGGGTACACAAATGGGACAAGG + Intergenic
959573593 3:107910768-107910790 TGCTGCACACAAATGACAGAAGG + Intergenic
960167447 3:114419795-114419817 TGGTGCACTCAGCATGCACACGG - Intronic
961500128 3:127326517-127326539 TGGTGCACATGGATGGTAGAGGG - Intergenic
961671930 3:128538914-128538936 TGGTTCAAACAGATCGCACAAGG - Intergenic
965932416 3:174061163-174061185 TGCTGCACACAGATTGTAAAAGG + Intronic
966397674 3:179519198-179519220 GGTCCCACACAGATGGCACATGG - Intergenic
966398429 3:179524307-179524329 GGTCCCACACAGATGGCACATGG + Intergenic
968066195 3:195761160-195761182 AGGTGGACACAGATGGAATAAGG - Intronic
968326063 3:197817557-197817579 TGGCCCACACAGATGGGAAAAGG + Intronic
968425988 4:523660-523682 TGTTCCACACAGAGGCCACACGG - Exonic
968669713 4:1842570-1842592 TGGTGCACACAGTGTGCACCTGG - Intronic
968903162 4:3440548-3440570 TGGTACACACAGCTGGCACTGGG - Intergenic
969904307 4:10378840-10378862 AGCTGCTCACAGATGTCACAAGG + Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
971230653 4:24798446-24798468 TGGTGCACACAGAGGAGGCATGG - Intronic
974663049 4:64919934-64919956 TGGGTCACAGAGAAGGCACATGG + Intergenic
975319100 4:72989769-72989791 TGGTGGTCACAGAGGGCACTGGG - Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979499982 4:121428575-121428597 TGGTGCACAGAGAAGGCAAAAGG + Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
984921497 4:184768218-184768240 AGGGTCATACAGATGGCACATGG + Intronic
987063861 5:14268831-14268853 CCGTGGACACAGATGGCACTGGG - Intronic
988615201 5:32768570-32768592 AGGGTCACACAGCTGGCACACGG - Intronic
988644398 5:33078310-33078332 TGGTGCACACAGACAACACATGG + Intergenic
989177468 5:38542650-38542672 AGGTGCACAGAGATGGCACTGGG - Intronic
991268139 5:64747077-64747099 TGTGGCACACAGAGAGCACATGG - Intronic
992008270 5:72500704-72500726 TGTTGCACACAGATTGATCAGGG - Intronic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
997024748 5:130045449-130045471 GGATGCACACAGAACGCACAGGG + Intronic
997519842 5:134515937-134515959 TGGTGGCTACAGATGGCAAAAGG - Intergenic
999123893 5:149231766-149231788 TGGTGCACAGATATGGCAACAGG - Intronic
1000302584 5:159969477-159969499 TGGTTGGCACAGATGCCACAAGG - Intronic
1002323630 5:178390561-178390583 AGGTGCCCACAGATGGCACTGGG - Intronic
1002360210 5:178664484-178664506 TGGGTCACTCAGATGCCACAGGG + Intergenic
1006193260 6:32222265-32222287 TGGTGCACAAAGGGGGCTCATGG + Intronic
1006295800 6:33169503-33169525 CGGAGGACACAGATGGCCCAGGG + Intronic
1006897421 6:37479959-37479981 GACTGCACCCAGATGGCACAGGG - Intronic
1007338157 6:41170289-41170311 TGGTGCACCCAGAAAGGACATGG - Intergenic
1013286934 6:108689810-108689832 TAGTGCACACAGAAGCCAGAAGG + Intergenic
1013820056 6:114144100-114144122 TGGTGAACACAGTTGCCACTGGG - Intronic
1017030346 6:150215510-150215532 TGGTGACCACAAATGGCAAATGG + Intronic
1018604733 6:165584859-165584881 TGGTGCTCCCAGAGGGCAAAGGG + Intronic
1018994584 6:168701314-168701336 TGGTGCTGCCAGATGGAACAGGG - Intergenic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1020685764 7:11291907-11291929 TGGTCTACCCAGATGGCACCGGG - Intergenic
1021492725 7:21236975-21236997 AGGTGCACACAGCTGGCAGCTGG - Intergenic
1021532184 7:21659116-21659138 TTTTGCACACAGATGACACTCGG - Intronic
1023762348 7:43478092-43478114 TGGTACTCAGACATGGCACAAGG + Intronic
1024880668 7:54082255-54082277 AGGTGCACAAGGAAGGCACATGG - Intergenic
1026877706 7:73889050-73889072 TGGTGAACTGACATGGCACATGG - Intergenic
1029724163 7:102391091-102391113 TGACTCACACAGATGGGACAGGG - Intronic
1034276591 7:149826518-149826540 TCCTGCACACAGATGGCACCAGG - Intergenic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1036156540 8:6347413-6347435 TTGAGAACCCAGATGGCACAGGG - Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1038581292 8:28751433-28751455 TGCTGCACACAGATGGCGCTGGG - Exonic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1042929348 8:73997880-73997902 TGGTGCACCCAGAGAGGACATGG - Intronic
1044819926 8:96149053-96149075 TTTTGCCCACAGATGGCTCATGG - Intronic
1045342514 8:101267378-101267400 GGGTGAACACAGGTGGCTCAGGG + Intergenic
1047701170 8:127450969-127450991 TGATGGTCACAGATGTCACAAGG - Intergenic
1048624903 8:136174459-136174481 TGGTGCAGACGGATCGCAGAGGG + Intergenic
1048866069 8:138762721-138762743 TGTGGCTCACAGAAGGCACATGG - Intronic
1048884390 8:138897997-138898019 TGGTGTCCTCAGATGGCAGATGG + Intronic
1049300675 8:141867804-141867826 TGGTTCACACAGAGGACACAGGG + Intergenic
1049873035 8:144995850-144995872 TGGTTCAAACAGATCACACAAGG - Intergenic
1050119456 9:2293432-2293454 TGGAGCACCCACATAGCACATGG - Intergenic
1053619861 9:39803831-39803853 TTGTGCACAGAGATAACACAGGG - Intergenic
1053878039 9:42563146-42563168 TTGTGCACAGAGATAACACAGGG - Intergenic
1053894625 9:42731219-42731241 TTGTGCACAGAGATAACACAGGG + Intergenic
1054233656 9:62538548-62538570 TTGTGCACAGAGATAACACAGGG + Intergenic
1054264296 9:62903612-62903634 TTGTGCACAGAGATAACACAGGG + Intergenic
1055286563 9:74734880-74734902 TGGGGCACACAAATGGCAGAAGG + Intronic
1055876450 9:80948221-80948243 TGGTGCACACACAGAGCAAAAGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1057717518 9:97506217-97506239 TGGTGCTCTGAGTTGGCACAGGG - Intronic
1059520696 9:114938905-114938927 TGTTGCACATAGATGTCTCAGGG + Intergenic
1061541276 9:131278848-131278870 AGGTGCCCACAGCCGGCACAGGG + Intergenic
1062016599 9:134294268-134294290 GGGTCCACACAGATGCCACCAGG + Intergenic
1187124924 X:16446052-16446074 TGGTTCACACAGAAGTCCCACGG - Intergenic
1187318556 X:18220509-18220531 TGGTGGACCGAGATGGCCCAGGG - Intronic
1189084703 X:38009809-38009831 TGGTTCACAGAGAGTGCACAGGG - Intronic
1192036042 X:67564006-67564028 TGATCCACACAGCTGGCAAATGG + Intronic
1195227692 X:102815274-102815296 TGGTGCCCACACACAGCACAGGG - Intergenic
1195288603 X:103409857-103409879 TGGTGCCCACACACGGCACAGGG - Intergenic
1200022379 X:153222780-153222802 TGGTGCACACAGATGAAAGCAGG - Intergenic
1200049639 X:153421921-153421943 TGAGGCACATAGATGGCACCTGG + Intergenic
1200957971 Y:8970572-8970594 TGGTTCTCACAAATGGCAGAGGG - Intergenic
1200986340 Y:9306085-9306107 TGGTTCTCACAAATGGCAGAGGG + Intergenic
1202107232 Y:21384230-21384252 TGGTTCTCACAAATGGCAGAGGG + Intronic
1202124238 Y:21554817-21554839 TGGTTCTCACAAATGGCAGAGGG - Intergenic
1202154770 Y:21874563-21874585 TGGTTCTCACAAATGGCAGAGGG + Intergenic