ID: 1036760399

View in Genome Browser
Species Human (GRCh38)
Location 8:11504736-11504758
Sequence ATCAGGCCTCATCTCAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036760399_1036760410 29 Left 1036760399 8:11504736-11504758 CCACCCTTGAGATGAGGCCTGAT 0: 1
1: 0
2: 2
3: 8
4: 78
Right 1036760410 8:11504788-11504810 CCCTGGTGCTCTCCAGCATGTGG No data
1036760399_1036760408 12 Left 1036760399 8:11504736-11504758 CCACCCTTGAGATGAGGCCTGAT 0: 1
1: 0
2: 2
3: 8
4: 78
Right 1036760408 8:11504771-11504793 ATATTTAGTGTTGGGCACCCTGG No data
1036760399_1036760407 4 Left 1036760399 8:11504736-11504758 CCACCCTTGAGATGAGGCCTGAT 0: 1
1: 0
2: 2
3: 8
4: 78
Right 1036760407 8:11504763-11504785 GTGCTGGCATATTTAGTGTTGGG No data
1036760399_1036760406 3 Left 1036760399 8:11504736-11504758 CCACCCTTGAGATGAGGCCTGAT 0: 1
1: 0
2: 2
3: 8
4: 78
Right 1036760406 8:11504762-11504784 GGTGCTGGCATATTTAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036760399 Original CRISPR ATCAGGCCTCATCTCAAGGG TGG (reversed) Intronic
900006516 1:58171-58193 ATTTGGCCTCATCCCAGGGGAGG + Intergenic
902246253 1:15122757-15122779 ATCAGTCCTCAGCTCAAGGTTGG - Intergenic
907359735 1:53904870-53904892 CCCAGGCCCCATCTCAAGGTTGG + Intronic
920169635 1:204063473-204063495 ATCAGGCCTGGCCTCATGGGTGG - Intergenic
1073089627 10:100924077-100924099 ATCAGGACGCTTCTCAAGGAAGG - Exonic
1076849384 10:133085752-133085774 TTCAGGTCTCATCTCCAGGGTGG - Intronic
1083717263 11:64584625-64584647 ATCAGGCCACATCTCAACACTGG - Intergenic
1083861670 11:65423310-65423332 ACCAGGCCTCATCCCCAGGCGGG - Intergenic
1088270123 11:108025871-108025893 TCCAGGCCTCATCACAAGGAGGG - Intronic
1089731622 11:120522936-120522958 AGCTGGCCCCATCTCAAGGCTGG + Intronic
1102804177 12:115764691-115764713 ACGAGCCCTCATCTCATGGGTGG + Intergenic
1106421368 13:29588979-29589001 ACCAGGCCTCATCCCAAGGGAGG + Intronic
1106764093 13:32896348-32896370 ATCAGGCCTCAATTCAGAGGGGG - Intergenic
1110706549 13:78605848-78605870 ATCTGGCCTCACCCCAAGGTGGG - Intergenic
1122801270 14:104230819-104230841 CTCAGGCCTCATCTCCATAGTGG - Intergenic
1202895033 14_GL000194v1_random:1964-1986 ATGTGGCCTCAGCTCTAGGGAGG + Intergenic
1129788032 15:78322170-78322192 ATCAGGCCTCTTGTCTTGGGGGG + Intergenic
1131262259 15:90893500-90893522 ATCAGGCATCAGCTCCAGAGGGG + Intronic
1132290880 15:100703143-100703165 ACCTGGCCTCATAACAAGGGAGG + Intergenic
1132447006 15:101932786-101932808 ATTTGGCCTCATCCCAGGGGAGG - Intergenic
1138761582 16:59550294-59550316 ATCAGACATCATCTGAGGGGTGG + Intergenic
1139680346 16:68556831-68556853 TTCAGGCATCATCTCAAGCATGG - Intronic
1140814195 16:78605394-78605416 GACAGGGCTCATGTCAAGGGAGG + Intronic
1142592303 17:1011736-1011758 AGCAAGCCTCCTCTCCAGGGAGG + Intronic
1144909651 17:18670916-18670938 AGCAGGCCTCATCTCAGAGCTGG - Intronic
1146933209 17:36792760-36792782 ATTGGGTCTCATCTCGAGGGTGG - Intergenic
1149564689 17:57632605-57632627 ATCAGGCCCCATCTCAAGGTTGG + Intronic
1151667173 17:75551650-75551672 CTCAGGCCACAAGTCAAGGGCGG - Intronic
1154500105 18:14991858-14991880 ATGTGGCCTCAGCTCTAGGGAGG + Intergenic
1157193724 18:45602491-45602513 CTCTGGCCTCACCCCAAGGGTGG + Intronic
1160638270 19:99747-99769 ATTTGGCCTCATCCCAGGGGAGG + Intergenic
1163623193 19:18372903-18372925 TGCAGCCCTCATCCCAAGGGGGG - Intergenic
1164868461 19:31624502-31624524 AACAGGACTCACCTCAAAGGTGG - Intergenic
927503618 2:23598818-23598840 CTCAAGCCTCATCTCAATGCTGG - Intronic
928323495 2:30302199-30302221 ATCAGACCTCATCTCCTGGGAGG + Intronic
938378327 2:130823034-130823056 TTCAGGCCTCAGCTCAGGGTGGG + Intergenic
938759160 2:134408205-134408227 CTCAGGCATCATCTCCTGGGAGG - Intronic
940802022 2:158143876-158143898 ATGAGGCCTCATGTCAGGTGAGG + Intergenic
943058547 2:183013555-183013577 ATCAGCTCTCATCTCAATGATGG + Intronic
1175486997 20:59353815-59353837 CTCAGGCCACATCTCAAGAGGGG - Intergenic
1175503513 20:59466592-59466614 TGCAGGCCTCATCTCCTGGGGGG + Intergenic
1176614735 21:9017951-9017973 ATGTGGCCTCAGCTCTAGGGAGG + Intergenic
1178397269 21:32253404-32253426 ATTAGGCCTGCTCCCAAGGGTGG + Intergenic
1178609970 21:34072377-34072399 ATCAGGCCCCATGCCAAGGCTGG - Intergenic
1181389922 22:22572923-22572945 ATCATGCATCATCCCATGGGTGG + Intergenic
1182822744 22:33232751-33232773 ATGAGGCCTATTCTCAAGGCAGG + Intronic
950868300 3:16207297-16207319 ATCAGGCCTGAACTTCAGGGTGG - Intronic
952125492 3:30294959-30294981 ATCAGTCCTCAACTCATCGGAGG - Intergenic
953974242 3:47370593-47370615 TTCAGCCATCTTCTCAAGGGAGG - Intergenic
954416409 3:50395567-50395589 ATCAGGCCTGGACTCAAGGATGG - Intronic
956152378 3:66257467-66257489 TTCAGGGCTCAACTCCAGGGAGG - Intronic
959572658 3:107901102-107901124 AGCAAGCCTCATCTAAATGGCGG + Intergenic
965776418 3:172236594-172236616 ACGAGGCCTCATCTCAAAGTAGG - Intronic
969289256 4:6228176-6228198 CCCAGGCCCCATCTCACGGGGGG - Intergenic
985224702 4:187747668-187747690 ATCAACCCACATCTCATGGGTGG + Intergenic
997241450 5:132311352-132311374 ATTAAGCAACATCTCAAGGGAGG - Intronic
1001512886 5:172336297-172336319 ATGGGGCCTCCTCTCAAGGGAGG + Exonic
1006936941 6:37725158-37725180 TTCAGGCCTCAGCACAATGGAGG - Intergenic
1007487882 6:42194906-42194928 ATCAGGCCTCCTGGAAAGGGAGG - Exonic
1007941594 6:45786461-45786483 ATCAGGCCTTTGCTCAAAGGAGG - Intergenic
1010300906 6:74257851-74257873 CTGAGGCCTCATCTGAAGGCTGG - Intergenic
1013284017 6:108664821-108664843 AGCAGGCCTCATCTCAGAGCTGG + Exonic
1013869315 6:114737844-114737866 ATCAGGCCTCAGCTCATGCAAGG - Intergenic
1016030934 6:139337247-139337269 ATCAAGTCTCTTGTCAAGGGTGG - Intergenic
1018935791 6:168273468-168273490 CTCAGGCATCAGCCCAAGGGCGG - Intergenic
1024879589 7:54070452-54070474 GAGAGGCCTCATCTCAAGGCTGG + Intergenic
1025236323 7:57237119-57237141 TTCAGGCCTCTGCTCAAAGGGGG + Intergenic
1026226189 7:68443579-68443601 ATCAGGCCTCACCTCTAGCACGG - Intergenic
1030122530 7:106124078-106124100 CTCAGGCCTCATCAAAAAGGTGG - Intergenic
1032486625 7:132292507-132292529 TTCAGGCGTCATCTCCAGGCAGG + Intronic
1033824193 7:145169469-145169491 ATCAAGCCTCTTCTCAATGCTGG - Intergenic
1035951001 8:4020762-4020784 TTCAGACCTTATCTCAAGGTTGG - Intronic
1036760399 8:11504736-11504758 ATCAGGCCTCATCTCAAGGGTGG - Intronic
1037679227 8:21080211-21080233 GTGAGACCCCATCTCAAGGGGGG + Intergenic
1039977805 8:42382145-42382167 ATGAGGCCTCAGATTAAGGGAGG - Intergenic
1040033452 8:42846254-42846276 ATTAAGCCACATCTTAAGGGTGG - Intergenic
1045375313 8:101567474-101567496 ATCAGGTCTCATCTAAAGGATGG + Intronic
1048837669 8:138536961-138536983 ATCAGATCTCAGCTCAGGGGGGG - Intergenic
1049615260 8:143573112-143573134 ATCAGGCCTCGACTCAGGGTGGG - Intergenic
1053417171 9:37953982-37954004 CTCAGCCTTCATCTCAAGGTGGG - Intronic
1055021573 9:71675645-71675667 AGCAGGCCCCATCTCCATGGTGG - Intergenic
1060236835 9:121870230-121870252 TTCAGGACTCAGCTCAAGGTAGG + Intronic
1061026007 9:128050194-128050216 CTCAGGCCTCATCTCAGCGGTGG - Intergenic
1061488245 9:130931128-130931150 AGCAGGCCTCTTCTCCAGGGTGG - Intronic
1061592274 9:131605370-131605392 CTCAGGGCCCTTCTCAAGGGAGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1187454028 X:19425308-19425330 AGAAGGCCTAATCTCAGGGGTGG + Intronic
1195143591 X:101989579-101989601 CTCAGGCATCATCTCCAGAGAGG - Intergenic
1196774415 X:119325389-119325411 ATCCAGGCTCATCTCAAGGTGGG + Intergenic