ID: 1036761021

View in Genome Browser
Species Human (GRCh38)
Location 8:11508617-11508639
Sequence CCAGGAGACCCGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036761021_1036761029 14 Left 1036761021 8:11508617-11508639 CCCTCTGCCTTCGGGTCTCCTGG 0: 1
1: 0
2: 3
3: 29
4: 258
Right 1036761029 8:11508654-11508676 CTAGTCAATCATTACTTACGGGG No data
1036761021_1036761027 12 Left 1036761021 8:11508617-11508639 CCCTCTGCCTTCGGGTCTCCTGG 0: 1
1: 0
2: 3
3: 29
4: 258
Right 1036761027 8:11508652-11508674 CACTAGTCAATCATTACTTACGG No data
1036761021_1036761028 13 Left 1036761021 8:11508617-11508639 CCCTCTGCCTTCGGGTCTCCTGG 0: 1
1: 0
2: 3
3: 29
4: 258
Right 1036761028 8:11508653-11508675 ACTAGTCAATCATTACTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036761021 Original CRISPR CCAGGAGACCCGAAGGCAGA GGG (reversed) Intronic
900089868 1:915446-915468 CCAGCACTCCCGAAGCCAGAGGG + Intergenic
900253488 1:1684079-1684101 CCAGGAGACCCGTGGGCCGCAGG + Intronic
901883886 1:12209461-12209483 CCAGGAGACCTGGAGGATGAAGG - Intergenic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902716379 1:18275742-18275764 GCAGGAGACAGGAAGCCAGATGG + Intronic
902768250 1:18630970-18630992 CTAGGAGACCCGGGGACAGACGG - Intergenic
903360531 1:22774191-22774213 CCAGGAAACCCAGAGGAAGAAGG - Intronic
903446316 1:23424692-23424714 GCAGGAGGCGCGAAGGCGGAGGG + Exonic
904710086 1:32423706-32423728 CAAGGAGACCCAAAGTCAGGCGG + Intergenic
905006582 1:34714747-34714769 CCAGGAGACAAGGAGGTAGAAGG - Intronic
906668182 1:47636413-47636435 CCAGGGGAAATGAAGGCAGAGGG - Intergenic
907364256 1:53946253-53946275 GCAGGCGACCCGAGGGCCGAGGG - Exonic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911499379 1:98666458-98666480 GCAGGAGATCCAAAGGCAGGAGG - Intronic
912708179 1:111930326-111930348 CCAGCACACCCAAAGGCAGAGGG + Intronic
913318722 1:117574254-117574276 ACAGGGGCCCCGAAGGCTGATGG - Intergenic
914681852 1:149944243-149944265 CCAGGAACCCCGGAGGCAGTTGG - Exonic
915225658 1:154409351-154409373 GGAGGAGAGCAGAAGGCAGAGGG - Intronic
915477669 1:156162566-156162588 CCAAGAGACTCAAAGGAAGAGGG + Intronic
916492424 1:165313697-165313719 GCAGAAGAGCTGAAGGCAGAAGG - Intronic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
917631865 1:176898310-176898332 CGAGGGGACCAGAAGGCAGTGGG - Intronic
917999619 1:180479904-180479926 GCTTGAGCCCCGAAGGCAGAGGG + Intronic
922365104 1:224856035-224856057 CCTGGAGACCCTAAGGCCCATGG - Intergenic
923773856 1:236960871-236960893 CTACGAGACGCGAAGGCAGGAGG + Intergenic
1063432092 10:5999689-5999711 CCTGCAGACCCGCAGGCAGCTGG - Intergenic
1064288271 10:14011524-14011546 CCAGGAGATTGGAAGGCAGATGG - Intronic
1065454827 10:25895927-25895949 CCAGGATAACCAAATGCAGAAGG + Intergenic
1068839010 10:61589385-61589407 CCAGGAGACAGGAAGAGAGATGG + Intergenic
1069641266 10:69956978-69957000 CAAGGAGAAAGGAAGGCAGAGGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1072310486 10:94149656-94149678 CCAAGAGACTCAAAGACAGAAGG - Intronic
1072966920 10:99981782-99981804 GCAGGAGGTCTGAAGGCAGAGGG + Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073066363 10:100761728-100761750 CCTGGAGACCAGTAGCCAGAGGG - Intronic
1076013088 10:127006255-127006277 GCAGGAGAGCAGAAGGCAGGAGG - Intronic
1076187198 10:128459149-128459171 CCAGGGAACCCGGTGGCAGATGG + Intergenic
1076633050 10:131863578-131863600 CTGGGAGAGCCGAAGGGAGAAGG + Intergenic
1076998318 11:310240-310262 GCAGGAGGCCCGAAACCAGAAGG - Intronic
1077000424 11:319518-319540 GCAGGAGGCCCGAAACCAGAAGG + Intergenic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1078338892 11:10485115-10485137 ACAGGGGACCCCAGGGCAGAGGG - Intronic
1078426314 11:11253857-11253879 CCAGGACACCTGCAGGCAGAAGG - Intergenic
1080648827 11:34206864-34206886 CCAGGAGAGGCAAAGGGAGATGG - Intronic
1080680234 11:34469107-34469129 CCAGGAAACCAGAAGTGAGAGGG - Intronic
1080862172 11:36159513-36159535 CCAGGGGAAGCCAAGGCAGAAGG + Intronic
1081118759 11:39237699-39237721 ATCGGAGACCAGAAGGCAGAAGG - Intergenic
1084007760 11:66332298-66332320 CCAGGGGAACCAGAGGCAGAGGG - Exonic
1084316033 11:68346435-68346457 CCAGGAGACCCCAGCGCAGTGGG - Intronic
1084767741 11:71323532-71323554 ACAGGAGGCCTGAAGGCAGGTGG + Intergenic
1085296555 11:75434820-75434842 CCAGCAGACCTCAAGGCAGAAGG - Exonic
1086595458 11:88565646-88565668 ACAGGAGTCAGGAAGGCAGATGG + Intronic
1087208994 11:95427073-95427095 CTATGAGACCCGAAGGGAGAGGG - Intergenic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1091037064 11:132243970-132243992 CCATGAGACGGGATGGCAGACGG - Intronic
1097908815 12:64947698-64947720 CAAGGAGACCTGAATGGAGAAGG - Intergenic
1101968183 12:109294895-109294917 CCAGGAGAGGCGAGGGCACATGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1103402140 12:120650311-120650333 CCTGGAGAGCTGATGGCAGAGGG - Intronic
1104246322 12:127045440-127045462 CAAGGAGACCCACAGTCAGATGG + Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284561 13:18993722-18993744 CCAGAAGGCCAGAAAGCAGAAGG + Intergenic
1105284609 13:18994024-18994046 GCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1105284639 13:18994173-18994195 CCAAAAGGCCAGAAGGCAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284940 13:18996008-18996030 CCAGATGAGCGGAAGGCAGAAGG + Intergenic
1105284961 13:18996109-18996131 CCCGGAGGCCAGAATGCAGAAGG + Intergenic
1105284975 13:18996189-18996211 CTAGAAGGCCAGAAGGCAGAGGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1113365871 13:109675503-109675525 CAAGGGAACCCAAAGGCAGATGG + Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113869906 13:113553018-113553040 CCAGGAGAGGAGAAGGCAGCAGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116759955 14:48999739-48999761 CCAGGAAACAGGAAGGAAGAGGG - Intergenic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119484949 14:74981088-74981110 ACAGGAGACCAGCAGGCAGCAGG - Intergenic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121774432 14:96581420-96581442 CCAGAAAACCCGAAGGAAGGGGG + Intergenic
1121916431 14:97840272-97840294 CCAGGAGACCAGAAGGCATCTGG - Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1122981908 14:105195881-105195903 GCAGGAGACCCCAGGGCACATGG + Intergenic
1125520563 15:40345837-40345859 GCAGGAGACCTGAAGGGAGGTGG - Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1129690746 15:77712040-77712062 CCAGGAAGTTCGAAGGCAGAGGG - Intronic
1132671490 16:1103833-1103855 CCAGGAGGCCCGGAGGCTGCAGG + Intergenic
1132994987 16:2818139-2818161 CCAGGAGACCCAAAGGGAACTGG - Intronic
1133201633 16:4207540-4207562 ACAGCAGAGCCAAAGGCAGAGGG - Intronic
1134849314 16:17468121-17468143 CCAGGAGACCAGAAGGGGGCAGG - Intronic
1135118072 16:19740475-19740497 GCAGCAGAACAGAAGGCAGAGGG - Intronic
1136470049 16:30473891-30473913 CCAAGGGGCCCCAAGGCAGAGGG - Intronic
1137789041 16:51159164-51159186 CCAGGAGACCCACAGGCAAAAGG - Intergenic
1138257357 16:55577900-55577922 TCAGGGGACCGGAAGCCAGATGG - Intronic
1142005475 16:87687759-87687781 CCAGGAGACCCCACGCTAGAGGG - Intronic
1142029016 16:87829243-87829265 CCAGGAGACCTGCAGCCAGGAGG + Intergenic
1142883924 17:2901162-2901184 ACAGGAGATCCAAGGGCAGATGG - Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1144151888 17:12455976-12455998 CCAAGAGAACCAAAAGCAGAGGG - Intergenic
1145833900 17:27939315-27939337 ACAGCAGACCCCAAGGCAGGAGG - Intergenic
1145969659 17:28949688-28949710 GCAGGAGCCCCGAGGGCAGCGGG + Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146948916 17:36892376-36892398 CCAGGAGGCCCGAGAGAAGAGGG - Intergenic
1147563340 17:41522074-41522096 CCAGGGGCCCCTGAGGCAGAGGG + Exonic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148140270 17:45323208-45323230 GCAGGAAACCCAAAGGTAGAAGG - Intergenic
1149491051 17:57085432-57085454 GCCGGAGACCCGAAGGCGGCGGG + Intronic
1150170980 17:62994254-62994276 CCAGGAACCCAGGAGGCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150718591 17:67594547-67594569 GCAGGAGGCCACAAGGCAGAGGG - Intronic
1151405706 17:73884869-73884891 ACAGGAGACCAGAAGGCGGGAGG - Intergenic
1151524341 17:74653967-74653989 TTAGGAGACCCCATGGCAGATGG + Intergenic
1151746243 17:76013427-76013449 CCAGGACAGCCGAGGGCAGCGGG - Intronic
1151917542 17:77129539-77129561 CCAGGAGATTCGAACTCAGAGGG - Intronic
1152073107 17:78143855-78143877 CCAGGAGTCCCCAAGGCTGGGGG - Intergenic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1154300070 18:13184835-13184857 CCAGGAGGGGTGAAGGCAGAAGG + Intergenic
1154503121 18:15006178-15006200 CCAGGAAGCTGGAAGGCAGAAGG + Intergenic
1155602286 18:27563398-27563420 CCCTGAGACCCAAAGACAGAAGG - Intergenic
1156326733 18:36080231-36080253 CTGGGAGACCTGAAGACAGATGG + Intergenic
1156875520 18:42005948-42005970 CCAGTAGGCCAGAAGTCAGAAGG - Intronic
1157575851 18:48742485-48742507 CAAGGAGGCCCGAATGCAGAAGG - Intronic
1158897349 18:61927512-61927534 CCAGAAGACCCCAGGGCAGATGG - Intergenic
1159902444 18:74060271-74060293 CCAGGAGAGCTGTAGACAGAGGG - Intergenic
1160055229 18:75472582-75472604 CCAGAAGAACCGATGGCAGCTGG - Intergenic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1160945882 19:1643933-1643955 CCAGGAGTCCCCAACGCTGATGG - Intronic
1161064148 19:2229321-2229343 CCAGGGGCCCCTGAGGCAGAAGG - Intronic
1161067774 19:2247105-2247127 CCAGGGGACCCCAAGCCCGATGG - Intronic
1161408758 19:4104661-4104683 CCAGGAGAAACGAAGACGGAAGG - Intronic
1161468672 19:4445770-4445792 CCTGGAGTCCCGGAGGGAGAGGG - Intronic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1163984473 19:20932080-20932102 CCACCAGACCCACAGGCAGAAGG - Intronic
1164239923 19:23376962-23376984 CCACCACACCCAAAGGCAGAAGG + Intronic
1164781487 19:30896929-30896951 CCTGGAGACCAGAAGGCCCAGGG + Intergenic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1166198904 19:41223595-41223617 CCTGGAGACCCCCAGTCAGAAGG - Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167125211 19:47544664-47544686 CCTGGAAACCCCGAGGCAGAGGG - Exonic
1167296797 19:48655116-48655138 CCAGGAGACTGGAACCCAGAAGG - Intergenic
925587478 2:5477583-5477605 ACAGGAGACCCAGAGGCAGCAGG - Intergenic
925785791 2:7430697-7430719 CAAGGGGACCCAAAGGGAGAAGG + Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
926923722 2:17965454-17965476 CCAGGAGAGCTGACTGCAGAGGG + Intronic
927730676 2:25468709-25468731 TCATGAGCCCCGAAGACAGAAGG - Intronic
928335598 2:30395373-30395395 CCAGGAGCCCTGAACCCAGAGGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
933200090 2:79438138-79438160 CATGGAGACGCGGAGGCAGAAGG + Intronic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
934076954 2:88436711-88436733 CCAGGAGACAGGAAGGGAAAGGG - Intergenic
935148206 2:100410572-100410594 CCTGGAGACCCTCAGGGAGAGGG - Intronic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
936728193 2:115348062-115348084 GTAGGAGACAGGAAGGCAGAAGG + Intronic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937722255 2:125115112-125115134 CCTAGAGACCAGAAGGCAGTTGG + Intergenic
937904910 2:127048388-127048410 AGAGGAGACCCCCAGGCAGAGGG - Exonic
938502291 2:131836348-131836370 CCAGGAAGCTGGAAGGCAGAAGG + Intergenic
938660009 2:133476705-133476727 GAAGGAGAACCGAAGACAGATGG - Intronic
939936063 2:148294874-148294896 AATGGAGACCAGAAGGCAGAGGG - Intronic
941643512 2:168014936-168014958 CCAGGAGTCCTGAAAACAGAAGG - Intronic
942108982 2:172661196-172661218 CCAGTAGACCTCCAGGCAGAGGG + Intergenic
942194395 2:173503188-173503210 CCAGGAGCCCTGAAGACAAATGG - Intergenic
942870306 2:180726461-180726483 TCAGGAGACCTTAAGGCACAGGG - Intergenic
944770691 2:202911624-202911646 AGAGGAGACCGGAGGGCAGAAGG - Exonic
946369149 2:219270108-219270130 CCAGGGGACCTGAAGGGAGTGGG - Intronic
948423100 2:237872479-237872501 CCAGGAGCCCCGGCTGCAGATGG - Intronic
948810302 2:240471905-240471927 CCAGGAGATCCCTGGGCAGATGG - Intergenic
948834453 2:240619495-240619517 CCAGGAGCCACTGAGGCAGAGGG - Intronic
948838166 2:240636276-240636298 CCAGCCCACCTGAAGGCAGAGGG - Intergenic
1169229185 20:3875740-3875762 CAAGGACACCCAAGGGCAGAGGG - Exonic
1174280111 20:49433143-49433165 CCAGGAGCCCCTAGGGCAGCAGG + Intronic
1175533572 20:59691188-59691210 CCAGGACACCCGAGGCCACATGG - Intronic
1175621920 20:60454660-60454682 ACAGGGGACTCGAAGTCAGATGG - Intergenic
1175714273 20:61245329-61245351 AAAGGAGACCCTAAGGAAGAAGG - Intergenic
1176023719 20:62975361-62975383 CCAGGAGCCCCAGTGGCAGAAGG + Intergenic
1176222374 20:63975758-63975780 CCAGGAGGCCCAGAGGCAGGAGG - Exonic
1177357755 21:20031191-20031213 CAAGGAGAACAGAAGACAGATGG - Intergenic
1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG + Intronic
1180126000 21:45790662-45790684 CCAGGAGACGCAAAAGCTGAGGG + Intronic
1181412624 22:22734814-22734836 CCAGGAGACCCGGACACGGAGGG - Intronic
1181424303 22:22823014-22823036 CCAGGAGACCCGGACGCGGAGGG - Intronic
1181428093 22:22856784-22856806 CCAGGAGACCCGGACACGGAGGG - Intronic
1182189229 22:28442297-28442319 TCAGGAGCCCCGCAGGCTGAAGG + Intronic
1182309932 22:29397397-29397419 CCAGGAGGACCCAAGGCTGATGG - Intronic
1182787642 22:32920827-32920849 GCAGGAGACTGGAAGGCAGAGGG + Intronic
1183132275 22:35850088-35850110 CCAGGACACAGAAAGGCAGATGG + Intronic
1183473879 22:38025075-38025097 CCAGGACACCAGGAGACAGAAGG - Intronic
1184050247 22:41998800-41998822 GCAGGAGGCCCGAAGCAAGATGG + Exonic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
949351708 3:3129932-3129954 CCATGAGAACTGAAGGAAGAAGG + Intronic
949578269 3:5360094-5360116 CCAGGGGAGCTGAAGTCAGAGGG + Intergenic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
952942555 3:38455041-38455063 CCTGGAGGCCCGAAGGAAGAGGG - Intronic
953017115 3:39088138-39088160 GCAGGAGAACCGAGTGCAGAAGG + Exonic
953774448 3:45803558-45803580 CCAGGAGACTGAAAGGCAGCAGG - Intergenic
954632568 3:52055385-52055407 CCAGGAGACCCCAACCCAAATGG + Intronic
955052399 3:55425309-55425331 CCAGGCAACCCGAAGGCTCATGG - Intergenic
956066929 3:65406538-65406560 TCGGGAGACCCAAATGCAGAGGG - Intronic
957514551 3:81233701-81233723 CCAGGAGAACCGATGTCTGAGGG + Intergenic
961026752 3:123565033-123565055 CCAGGAAACCCACAGTCAGATGG - Intronic
961584394 3:127910226-127910248 CCAGGAGACCTGGAGGTGGAGGG + Intergenic
966532088 3:180992464-180992486 TCAGGAGATCAGAAGGCAGGAGG + Intergenic
967946486 3:194807994-194808016 GCAGGAGACCCGGGAGCAGAAGG + Intergenic
968281805 3:197482840-197482862 CCAGGAGAGACAGAGGCAGAAGG + Intergenic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
968791135 4:2663190-2663212 CCAGGGGCCCCGAAGGAAGATGG + Exonic
968898831 4:3421132-3421154 ACAGGCGGCCCGCAGGCAGAGGG - Intronic
972174429 4:36386142-36386164 GCAGGAGATCAAAAGGCAGAAGG - Intergenic
972921309 4:43945880-43945902 CCAGAAGACTGGAAGGCACATGG + Intergenic
976789269 4:88859405-88859427 CCAGGAGATGGGAAGGAAGAAGG + Intronic
980480550 4:133381528-133381550 CCAGGAGCACTGAAGTCAGAAGG - Intergenic
982134018 4:152256808-152256830 GCAGGAGACCCGCAGGGAGGCGG - Intergenic
993968479 5:94387720-94387742 CCAGGAGATCCATAGGCACAGGG + Intronic
994276876 5:97849367-97849389 ACAGGAGACCTGAAGGCAGGTGG + Intergenic
994445691 5:99870619-99870641 CAAAGAGACCCTATGGCAGAAGG + Intergenic
994919448 5:106024514-106024536 ACAGGAGAACCGAAGGCAGAAGG + Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
996367506 5:122718768-122718790 CAAGGAGACCAGAAGTTAGATGG - Intergenic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998185925 5:139980121-139980143 CCAGGACATCCGGAGGCAGATGG + Intronic
1001135788 5:169101522-169101544 CAAGGAGTCCTGGAGGCAGATGG - Intronic
1001920833 5:175598007-175598029 GCAGGAGAGACCAAGGCAGAGGG + Intergenic
1002408331 5:179053775-179053797 CTAGGAGACTCCATGGCAGATGG - Intergenic
1002870634 6:1164580-1164602 CAAGGAGAGCCCAAGGCAGAGGG + Intergenic
1003651885 6:7968519-7968541 CCAAGATGCCCGAAAGCAGAAGG + Intronic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1013978165 6:116100620-116100642 CTAGGAGCCCAGAAGGCAGTAGG - Intergenic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1014856860 6:126412376-126412398 CAAGGAGGCCAGAAGGCAGTGGG - Intergenic
1015671330 6:135693257-135693279 CCTGGAGAAGAGAAGGCAGAAGG + Intergenic
1018293780 6:162322521-162322543 CAATGAGACCCGAAGTCAGATGG - Intronic
1018567691 6:165172910-165172932 CAGGGAGACGTGAAGGCAGAAGG + Intergenic
1019357812 7:590101-590123 CCTGGAGACCAGAAGACAGAGGG + Intronic
1024292121 7:47812279-47812301 CCAGGGGACCCTCAGGCAGGAGG + Intronic
1028475082 7:91244566-91244588 CCAGGAGATCCTGAGGCAGCAGG - Intergenic
1032069428 7:128794680-128794702 CCAGGAGCCCTGCAGGGAGAGGG - Exonic
1032072956 7:128820711-128820733 CCAAGAGATCCGGAGGCTGAGGG - Intronic
1032422474 7:131793715-131793737 CCATGTGACCCCAAAGCAGAAGG - Intergenic
1032507408 7:132446030-132446052 CCAGGAGCCCCGATGGAGGAAGG + Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1034886674 7:154803710-154803732 CCAGGAGAGGAGCAGGCAGAAGG + Intronic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1035410163 7:158633570-158633592 GCAGGAGACCCTGAGGCAGCAGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1038575532 8:28701229-28701251 CGAGAAGACCCGACCGCAGATGG - Intronic
1038718329 8:30011594-30011616 CCCAGAGACCCAAAGGCACAGGG + Intergenic
1039466566 8:37789046-37789068 CCAGGAGCCCTGAAACCAGATGG + Intronic
1040915275 8:52562558-52562580 CCAGGAAACCCTGAGGCAGGAGG - Intronic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1046708050 8:117477773-117477795 CCAGGAGGCAGGAAGGCAGTGGG + Intergenic
1047365764 8:124209940-124209962 CCTGGAGATCTGAAAGCAGATGG - Intergenic
1048065843 8:130967843-130967865 CCAGGAGACCCCAATGCATAAGG + Intronic
1048498118 8:134952203-134952225 CCAGGGGACAGGATGGCAGAAGG - Intergenic
1048517048 8:135120695-135120717 CAAGGACATCAGAAGGCAGAAGG - Intergenic
1049090565 8:140511107-140511129 CCACGAGGCCCGGAGTCAGAGGG + Intergenic
1049181546 8:141225695-141225717 CCGGGAGACAAGAAGGCACAGGG + Intronic
1049279719 8:141738112-141738134 CCAGGAGCCCCGGGGGGAGATGG + Intergenic
1049279737 8:141738171-141738193 CCAGGAGCCCCGGGGGGAGACGG + Intergenic
1049406030 8:142452220-142452242 CCGGGAGACCCGGCGGCTGAGGG + Intronic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1049653793 8:143789016-143789038 CCAGGAGGCCCAGAGGCACAAGG + Intergenic
1049796156 8:144498153-144498175 CCGGGAGGCCTGGAGGCAGAGGG + Intronic
1050267806 9:3909096-3909118 CCAGAAGAAACGAAGCCAGAAGG + Intronic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1052915511 9:33922191-33922213 GAAGAAGACCTGAAGGCAGATGG + Exonic
1055151697 9:73008414-73008436 GCGGGAGAACGGAAGGCAGAAGG - Intronic
1057723659 9:97553624-97553646 CCATGAGACCCCATGCCAGAGGG + Intronic
1058740828 9:107940505-107940527 CCAGGACATCCTGAGGCAGAGGG - Intergenic
1060690305 9:125651862-125651884 CCAGAAGACCCTTAGGCTGAAGG + Intronic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061571256 9:131478673-131478695 CCAGGAAACCCAGAGCCAGAGGG + Intronic
1061958659 9:133976974-133976996 CCTGGACACCCCAAGGCTGAAGG + Intronic
1062062443 9:134503693-134503715 CCAGTAGACCTGAAGGATGAGGG - Intergenic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062189327 9:135239632-135239654 CCAGGAGATCCCAAGGTAGATGG - Intergenic
1186781994 X:12922053-12922075 CCTGACAACCCGAAGGCAGAAGG + Exonic
1188848425 X:35102749-35102771 GCAGGAGACCCAAAGGAGGAAGG + Intergenic
1190278959 X:48917348-48917370 CCATGGGACCCAAAGGGAGAGGG - Intronic
1192502446 X:71662862-71662884 CCAGGCGCCCCGCAGGGAGAGGG + Intergenic
1192509644 X:71714238-71714260 CCAGGTGCCCCGCAGGGAGAGGG + Intergenic
1192511116 X:71720922-71720944 CCAGGCGCCCCGCAGGGAGATGG - Intergenic
1192515581 X:71760631-71760653 CCAGGCGCCCCGCAGGGAGATGG + Intergenic
1192517053 X:71767315-71767337 CCAGGTGCCCCGCAGGGAGAGGG - Intergenic
1192528789 X:71869385-71869407 CCAGGAGTCCCCCAGGGAGAGGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195327987 X:103773596-103773618 CCAAGAGAACCGAGGGCTGAGGG - Intergenic
1196549617 X:117007509-117007531 CCAGCAGATCCGAATGCTGAGGG - Intergenic