ID: 1036761198

View in Genome Browser
Species Human (GRCh38)
Location 8:11509581-11509603
Sequence AGACCCGGCAGAGCACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036761198 Original CRISPR AGACCCGGCAGAGCACCCCC AGG (reversed) Intronic
900024490 1:258826-258848 ATCCTCGGAAGAGCACCCCCAGG - Intergenic
900028098 1:348231-348253 ATCCTCGGAAGAGCACCCCCAGG - Intergenic
900403059 1:2480540-2480562 AGAGCTGGCAGAGCAGCCCCCGG - Intronic
901144305 1:7054721-7054743 TGACCCGGGAGAGCAGCCTCTGG + Intronic
904576581 1:31508965-31508987 AGACCCGGAAGGACACTCCCAGG - Intergenic
905453850 1:38074218-38074240 AGACACGGCAGGACACCCCAAGG - Intergenic
905480970 1:38261743-38261765 AGTTCCAGCAGAGCAGCCCCTGG - Intergenic
907671463 1:56477904-56477926 AGACCCGGCAGAGCCCCGCGGGG + Intergenic
913209467 1:116570921-116570943 AGACCACGCTGAGGACCCCCAGG + Exonic
915331452 1:155115223-155115245 AGTCCCAGCACAGCAGCCCCAGG - Intergenic
915620990 1:157084044-157084066 AGACCAGGCAGGGCAACCACAGG - Intergenic
917959690 1:180132351-180132373 GAACCCAGCAGACCACCCCCAGG - Intergenic
918464602 1:184808471-184808493 AGACCCAGCGGTGCACCCACGGG + Intronic
919570683 1:199243521-199243543 AGGCCCGGGAGAGCACCTCATGG + Intergenic
920380150 1:205530447-205530469 AGCCCCAGCAGAGCAGCCCCGGG + Intronic
922423034 1:225471970-225471992 AGACCTAGCAGGGCAGCCCCGGG + Intergenic
923010842 1:230086331-230086353 CGACCCAGCAGAGCACCTCCTGG + Intronic
923018440 1:230145020-230145042 AGGCCCGGCGGAGCATCCCAAGG + Intronic
924539088 1:244964246-244964268 AGACCCGGCACAGGAAGCCCGGG - Intergenic
924956818 1:248936759-248936781 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1063674351 10:8126802-8126824 AGACCAGGCAGAGTAAGCCCAGG - Intergenic
1069709828 10:70481095-70481117 AGACCCAGCAGAGCACAGACGGG + Intronic
1070932967 10:80273756-80273778 AGACCAGGCCCAGCTCCCCCTGG + Exonic
1075794530 10:125109707-125109729 AGCCCTGTCAGAGCACTCCCAGG + Intronic
1076604111 10:131678240-131678262 AGACCAGGCAGAGCGCTCCTCGG + Intergenic
1076912994 10:133401707-133401729 TGTCCCCGCTGAGCACCCCCGGG + Intronic
1076962711 10:133778420-133778442 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1077107434 11:848281-848303 AGACCCACCAAAGAACCCCCAGG + Intronic
1077240671 11:1508845-1508867 AGACCCGGAAGCCCACTCCCAGG + Intergenic
1077307554 11:1874849-1874871 AGGCCCGGCAGGGCCCCCCTTGG + Intronic
1077328699 11:1974625-1974647 AGGCCCGGCAGGGCACCCCTCGG - Intronic
1077486973 11:2843437-2843459 AGACCAGGCAGGGCCTCCCCAGG - Intronic
1077535052 11:3120079-3120101 AGAGCTGGCAGGGCAGCCCCGGG + Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1083326080 11:61873698-61873720 AGGGCAGGCAGGGCACCCCCAGG + Exonic
1083619392 11:64041492-64041514 ACACCCTCCAGAGCAGCCCCGGG - Intronic
1085396356 11:76208959-76208981 AGCCCCGGCTTAGCGCCCCCTGG - Intronic
1089696571 11:120219541-120219563 AGAGACGGCAGAGCACCCCTGGG - Intronic
1091144443 11:133265337-133265359 AGACCCTGCAGAGCAGAACCTGG - Intronic
1202811678 11_KI270721v1_random:29804-29826 AGGCCCGGCAGGGCACCCCTCGG - Intergenic
1091716633 12:2782076-2782098 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1092936027 12:13365709-13365731 AGACCCGGCAGAACATCAGCCGG - Intergenic
1098521632 12:71440139-71440161 AGACCTGGGAGAGCTGCCCCCGG - Exonic
1104307333 12:127621550-127621572 AGACAGGGCATATCACCCCCAGG + Intergenic
1104429616 12:128705758-128705780 TGGCCAGGCAGAACACCCCCAGG - Exonic
1104760567 12:131295479-131295501 AGGCCCGTCAGAGCCGCCCCAGG + Intergenic
1104819208 12:131665306-131665328 AGGCCCGTCAGAGCCGCCCCAGG - Intergenic
1105418307 13:20232017-20232039 AGAGCCGGCAGAGCGCGGCCGGG - Intronic
1107747800 13:43530374-43530396 AGACTCTGCAGATCACCCCCAGG - Intronic
1113640564 13:111954025-111954047 AGACAAGGCCCAGCACCCCCGGG - Intergenic
1113681188 13:112246165-112246187 AGTCCCCTCAGTGCACCCCCGGG + Intergenic
1113796454 13:113061459-113061481 AGGCACCGCAGAGCACCCCATGG + Intronic
1117895933 14:60486103-60486125 AGACCCCGCGGAGCACGCCGCGG + Intronic
1118302239 14:64626037-64626059 AGACCCGGCAGAGGCCCTCACGG - Intergenic
1118865750 14:69702337-69702359 ATACCCGGCAGTCCACCACCTGG + Intronic
1120712292 14:87805419-87805441 AGACACTGCACAGCGCCCCCTGG - Intergenic
1122238449 14:100345982-100346004 AGCCCCGGCAGCGCATCCCAGGG + Intronic
1122691404 14:103533609-103533631 GAACCCGGCAGAGCCTCCCCTGG + Intronic
1123032010 14:105456383-105456405 AGACCCTGCAGAGCTCCGCCAGG - Intronic
1124494571 15:30178533-30178555 TGACACGGCAGAACACACCCCGG + Intergenic
1124748999 15:32360112-32360134 TGACACGGCAGAACACACCCCGG - Intergenic
1127771033 15:62230896-62230918 AGACCCTGCTGAGCACCCAGGGG + Intergenic
1129231435 15:74199220-74199242 TGACCCAGCAGAGCATCCCAGGG - Intronic
1130546061 15:84858168-84858190 AGACCTGTCAGAGCCTCCCCTGG - Exonic
1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG + Intronic
1131269014 15:90935353-90935375 AGCCCCGGCCGGCCACCCCCGGG + Exonic
1142307970 16:89295943-89295965 ACTCCCTGCAGAGCACCCCCAGG - Intronic
1145790414 17:27623159-27623181 AGCCCTGGCAGAGCTGCCCCTGG - Exonic
1146339644 17:32007780-32007802 AGACGCGGCTGAGCTCGCCCAGG + Intergenic
1150407937 17:64919059-64919081 AGACGCGGCTGAGCTCGCCCAGG - Intronic
1150747285 17:67825906-67825928 AGACGCGGCTGAGCTCGCCCAGG + Exonic
1151780047 17:76239944-76239966 AGACCCGGCAGGACGCCCCTTGG + Intronic
1152377497 17:79926435-79926457 AGCCCCTCCAGAGCAGCCCCAGG + Intergenic
1152987037 18:330427-330449 AGACCCTGCAGGGCTCCACCAGG - Intronic
1155223792 18:23710089-23710111 ATCCTCGGCAGAGCGCCCCCAGG - Intronic
1160835165 19:1121575-1121597 AGGCACGGCAGGGCACCCCTTGG - Intronic
1163832068 19:19551826-19551848 AGTCCTGGCGAAGCACCCCCAGG - Intergenic
1164735734 19:30539703-30539725 AGACCTTCCAGAGTACCCCCAGG - Intronic
1165007429 19:32818332-32818354 AGACCTGGCCCAGCACCTCCGGG - Intronic
1165100474 19:33435845-33435867 AGAGCCTGGAGGGCACCCCCTGG - Intronic
1166063662 19:40343554-40343576 AGACCAGGCACAACACCTCCAGG - Intronic
1167145404 19:47678571-47678593 AGACCCAGCGGGGCACCCTCAGG - Intronic
1167504229 19:49862801-49862823 AGACCAGGCGAAGCAGCCCCAGG - Intronic
1167748640 19:51367304-51367326 AGACCCGGCAGAGACCCCCTTGG - Intronic
1168727857 19:58599144-58599166 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
925182997 2:1829166-1829188 GGACTGGGCAGAGCACTCCCTGG + Intronic
936570702 2:113612048-113612070 AGCCTCAGAAGAGCACCCCCAGG - Intergenic
937976767 2:127587169-127587191 AGACCAAGCAGTGCAGCCCCTGG + Intronic
938729739 2:134137369-134137391 AGCAGCGGCAGAGCACCCTCTGG - Intronic
942542255 2:177026606-177026628 GGACCCGGCACAGCTCCCACTGG - Intergenic
947597988 2:231426045-231426067 AGAGCTGTCAGAGCAACCCCCGG + Intergenic
948567382 2:238895731-238895753 AGCCCCGGTAGAGCCCGCCCTGG + Intronic
948701328 2:239762292-239762314 ACACCAGGCAGAGGCCCCCCTGG + Intergenic
948716681 2:239869768-239869790 ACACCCGGCAGCACACTCCCAGG - Intergenic
949088154 2:242175346-242175368 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1169047596 20:2547328-2547350 ACATCAGGCAGAGCACCACCAGG + Intronic
1169077664 20:2771367-2771389 AGACATGGCAGAGAATCCCCTGG + Intergenic
1175410146 20:58762398-58762420 CGAGCCAGCAGAGCAGCCCCAGG + Intergenic
1175943237 20:62547442-62547464 GGTCCCGGAAGAGCACCCCGGGG - Intergenic
1179367364 21:40771030-40771052 GGACATGGCATAGCACCCCCAGG + Intronic
1180263294 21:46690938-46690960 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1181046167 22:20215330-20215352 AGACCCAGCACTGCACCCTCAGG - Intergenic
1181449755 22:23011651-23011673 ACAGCCAGCAGAGCTCCCCCTGG - Intergenic
1183537805 22:38413239-38413261 AGACCAGGCCGAGCAGCCCGAGG - Intergenic
1185115333 22:48931568-48931590 AGACCCAGGAGAGCACCACAGGG + Intergenic
1185421920 22:50739536-50739558 AGACGCTGCACAGCATCCCCGGG - Intronic
1185429497 22:50798832-50798854 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
954296300 3:49676241-49676263 AGGCCCGGCAGGGCAGCCCTGGG + Intronic
954730702 3:52659060-52659082 AGACTTGGTAGAGCACCCCGTGG - Intronic
961322069 3:126083491-126083513 ACTCCCGGCTGGGCACCCCCAGG + Intronic
968433646 4:574549-574571 CCACCAGGCAGAGCAGCCCCAGG + Intergenic
968615955 4:1577963-1577985 AGAACCCCCAGAGCATCCCCGGG - Intergenic
968663555 4:1809045-1809067 AGCCAGGGCAGTGCACCCCCAGG - Intergenic
969714045 4:8860009-8860031 AGAACCGGCAGAGCCCCGACGGG + Intronic
972335956 4:38107209-38107231 AGACCCGGCAGTGGAGTCCCAGG + Intronic
972638868 4:40908193-40908215 AAACCCGGGAGAGCGGCCCCAGG + Intronic
974664081 4:64935643-64935665 AGACCCATCAGAGCCCCACCTGG + Intergenic
979174954 4:117651706-117651728 TTACCAGGCAGAGCACCCCCTGG - Intergenic
985465942 4:190195900-190195922 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
985641663 5:1066143-1066165 AGACCCAGCAGGGCAGGCCCTGG - Intronic
985671841 5:1210806-1210828 AGAGCAGGCACAGCCCCCCCGGG - Intronic
985678496 5:1244209-1244231 AGACCAGGCAGACCAGCCCTGGG - Exonic
985873472 5:2577470-2577492 AGGGCTGGCAGAGGACCCCCAGG - Intergenic
985877726 5:2613088-2613110 AGAGCCGCCACAGCACCCCCGGG - Intergenic
986279596 5:6312501-6312523 AGAGCAGGCAGAGGAACCCCAGG + Intergenic
988722490 5:33892283-33892305 AGACCCGGGAGAGCCGCCCTGGG + Intergenic
991911137 5:71562272-71562294 AGACCTGGCAGAAGACCCCTGGG + Exonic
992023943 5:72652531-72652553 AGAGACGGCAGAGCACACCTTGG + Intergenic
993147551 5:84114444-84114466 AATTCCTGCAGAGCACCCCCTGG + Intronic
996661088 5:126003556-126003578 AGACCCTGCAGGGCACGCCATGG + Intergenic
997859171 5:137400931-137400953 TTACCCAGCAGAGCACCCGCTGG + Intronic
1002745892 5:181472140-181472162 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1007119929 6:39371294-39371316 AGGCCCAGCATACCACCCCCAGG - Intronic
1015689163 6:135901637-135901659 TGACCCGGCAGCACACCCCAGGG + Intronic
1018644261 6:165932910-165932932 AGACCAGGCAGAGTTCACCCAGG + Intronic
1019250809 6:170745695-170745717 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1019268753 7:134169-134191 AGACCCTGCCAAGCAGCCCCTGG + Intergenic
1019469600 7:1211683-1211705 AGACACTGGAGAGCTCCCCCGGG + Intergenic
1019774107 7:2902073-2902095 AGCACCGGCAGAGCACCACATGG + Intergenic
1020023329 7:4882294-4882316 CGACCGGGCGGAGCACGCCCTGG + Intronic
1020244593 7:6420897-6420919 TGACCCGGCAGAGCGCCCGTGGG + Intronic
1020260039 7:6526144-6526166 TGACCCGGCAGAGCCACCACGGG + Intronic
1023022431 7:36022115-36022137 AAAGCAGGCAGAGCAGCCCCTGG - Intergenic
1024542916 7:50493436-50493458 GGACCAGGCAGAGCATCCACAGG - Intronic
1024866637 7:53910671-53910693 AGACCCAGGCGAGGACCCCCTGG - Intergenic
1026805698 7:73428859-73428881 AGACGCTGCAGAGCACAGCCAGG + Intergenic
1034343540 7:150372315-150372337 GGCCCCGCCAGAGCACCCGCAGG + Exonic
1035513746 8:213511-213533 ATCCTCGGAAGAGCACCCCCAGG - Intergenic
1035607413 8:939000-939022 AGACGCAGCAGAGCAGCCACCGG + Intergenic
1036761198 8:11509581-11509603 AGACCCGGCAGAGCACCCCCAGG - Intronic
1037975375 8:23207073-23207095 AGACTCTGGAGAGCACCCCCAGG + Intronic
1040284344 8:46092313-46092335 AGAACCCCCAGAGCGCCCCCTGG + Intergenic
1042784993 8:72537048-72537070 CGAGCCGGCAGCGCACCGCCGGG - Intergenic
1049479804 8:142816535-142816557 AGCCCCGGCAGTGCACCCTCGGG + Intergenic
1049748997 8:144274753-144274775 AGGCCTGGCAAAGCACCCCCAGG + Intronic
1056257961 9:84819612-84819634 AGACCTGCCAGTGCACCCCATGG - Intronic
1059450487 9:114368454-114368476 GGGCCCGGCCGAGGACCCCCAGG - Exonic
1060489221 9:124069843-124069865 AGACCCAGCAAGGCACCACCTGG - Intergenic
1061177448 9:129006308-129006330 GGACCCGGCTGTGCACCCCCGGG + Exonic
1061869841 9:133514848-133514870 AGACCCAGCAGAGCCCCTTCAGG + Intronic
1061971411 9:134047414-134047436 AGACCCGGTGGAGCTCACCCTGG + Intronic
1061991156 9:134159413-134159435 AGAGCTGGCTGAGCTCCCCCAGG - Exonic
1062010573 9:134264662-134264684 TGAGACGGCAGAGCACACCCTGG - Intergenic
1062016090 9:134292077-134292099 AGCCCTGGCAGAGGAACCCCAGG - Intergenic
1062368616 9:136224500-136224522 AGACCCCGCAGGCCACACCCTGG - Intronic
1062483668 9:136763783-136763805 TGAGCCGGCTGTGCACCCCCAGG - Exonic
1062615079 9:137392680-137392702 AGAACAGACACAGCACCCCCTGG - Intronic
1203580361 Un_KI270745v1:38292-38314 ATCCTCGGAAGAGCACCCCCAGG + Intergenic
1186369045 X:8927832-8927854 AGACCCCGCAGCGCTCTCCCTGG + Intergenic
1190165769 X:48071721-48071743 AGGCTGGACAGAGCACCCCCCGG + Intergenic
1200105635 X:153710502-153710524 AGAAAGGGCAGAGCAGCCCCAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic