ID: 1036763963

View in Genome Browser
Species Human (GRCh38)
Location 8:11534558-11534580
Sequence GAGCAGACCTTCAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036763963 Original CRISPR GAGCAGACCTTCAGGAAGGA AGG (reversed) Intronic
900157441 1:1208892-1208914 GGCCAGACCTCCAGGCAGGATGG - Intergenic
901683350 1:10929145-10929167 GAGCATACTTTCAGGTTGGAAGG + Intergenic
901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG + Intergenic
902045599 1:13521674-13521696 GAGGAGATCATGAGGAAGGAGGG - Intergenic
904358039 1:29954174-29954196 GAGCTGCCCTTCAGGAAGAGAGG + Intergenic
905395690 1:37665055-37665077 GGGCTGCCCTGCAGGAAGGAAGG - Intergenic
906054685 1:42906266-42906288 GCCCAGACCTTTAGGAATGAAGG - Intergenic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
907563485 1:55412637-55412659 GATCAGATCTTAAGGGAGGAGGG + Intergenic
908983867 1:69992817-69992839 GAGAAAACCTTGAGGAAGGTTGG - Intronic
909032620 1:70560383-70560405 GCCCAGATCTTCAGGAATGAAGG - Intergenic
909332040 1:74425130-74425152 GAGTAGAGCTTCAGGCAGAAGGG + Intronic
909442482 1:75713388-75713410 GAGAAGACCTTCATGCAGAAAGG - Intergenic
910734338 1:90435671-90435693 GAGCAGACCATTAAGAAGAAAGG - Intergenic
911479845 1:98424344-98424366 GAGGAGACCTTAAGGAAGTGAGG - Intergenic
914341960 1:146767288-146767310 GAGGAGACCTGCAGGTTGGATGG + Intergenic
916001194 1:160617708-160617730 CAGGAGGCCTTCAGGAAGTACGG + Intronic
918115491 1:181492820-181492842 CTCCTGACCTTCAGGAAGGAGGG - Intronic
918465808 1:184820432-184820454 GAGCAGAGGTAGAGGAAGGAAGG - Intronic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
920224625 1:204429644-204429666 GAGCGGAGCCTCAGAAAGGAAGG - Intronic
920943311 1:210504651-210504673 CATCAGATCATCAGGAAGGAGGG - Intronic
922094576 1:222432073-222432095 GAGAAGAACTTGAGTAAGGAAGG - Intergenic
922507708 1:226136055-226136077 GAGCCGACTTTCAAGGAGGAAGG + Intergenic
922626533 1:227051249-227051271 GAGCTGATCTTAAGGTAGGATGG + Intronic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923448090 1:234091338-234091360 GAGAAAACCTACAGGAAGAAAGG - Intronic
923524269 1:234760147-234760169 GCGCAGAACCTCGGGAAGGAGGG - Intergenic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1063672999 10:8114961-8114983 GAGAAGAACTTTAGGAATGAAGG - Intergenic
1063745714 10:8878213-8878235 GAGCAGGCCATCTGGAAAGACGG + Intergenic
1065543750 10:26797618-26797640 CAGCAGACAGTCAAGAAGGAAGG + Intronic
1067543811 10:47177440-47177462 GAGAAGGCCTTCAGGAAGATGGG - Intergenic
1067967220 10:50926327-50926349 TGGCAGACCTTCAGCAAGAAAGG - Intergenic
1068558871 10:58490064-58490086 AACCAGACCTTCAAAAAGGAAGG - Intergenic
1069930849 10:71880684-71880706 GAGGAGACCTCCAGGATGCAGGG - Intergenic
1070784630 10:79155850-79155872 GGGCAGTCTTTCAGGCAGGAGGG - Intronic
1071292230 10:84196109-84196131 GAGCAGCCATTAAGGCAGGAGGG - Intronic
1072372478 10:94778366-94778388 GAGCAGGCCTTCTGAAAGGTCGG - Intronic
1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG + Intergenic
1074563354 10:114554011-114554033 GAGGAGACCATGAGGAAGTAGGG + Intronic
1076342886 10:129761711-129761733 GAGCACAGCATCAGGCAGGAGGG + Intronic
1076928627 10:133510705-133510727 CACAAGACCTTCAGGAAGGCAGG + Intergenic
1077173844 11:1180007-1180029 GAACAGAGCTGCAGGGAGGAAGG - Intronic
1077535155 11:3120473-3120495 GAGCGGCCCTCCAAGAAGGACGG - Exonic
1078183075 11:9028735-9028757 GGGCAGCCCTTCAGGACTGAAGG - Intronic
1078326159 11:10382851-10382873 GAGCTGAAACTCAGGAAGGAAGG - Intronic
1079987156 11:27211553-27211575 GGGCAGACATTCAGGTGGGAGGG - Intergenic
1080283884 11:30586380-30586402 GAGCACAGCTCCAGGAAGCAGGG + Intronic
1082186079 11:49182831-49182853 GAGAACACCTACAGGAAGCATGG + Intronic
1082200709 11:49363225-49363247 AAGCAGACCAGTAGGAAGGAGGG + Intergenic
1083190380 11:61047710-61047732 GGGCAGACCTTCAGGAATTGAGG + Intergenic
1083227836 11:61295614-61295636 GTGCAGACCTTCTGGCAGGCTGG - Intergenic
1083847015 11:65341404-65341426 GACCAGACCCTGAAGAAGGAGGG + Exonic
1084331007 11:68430629-68430651 AAGCAGGCAGTCAGGAAGGAAGG - Intronic
1084992349 11:72939221-72939243 CAGAGGACGTTCAGGAAGGAAGG + Intronic
1085198648 11:74688056-74688078 GGGCTGATATTCAGGAAGGATGG - Intergenic
1086941852 11:92806648-92806670 CAGCAAACATTCAGAAAGGATGG - Intronic
1087223921 11:95576869-95576891 GAGCAGACCTACAGGAACTGTGG + Intergenic
1087594377 11:100235359-100235381 GAGCAGGCCTTCTGAAAGGTTGG + Intronic
1088053747 11:105551105-105551127 GAACAGAGGTTCAGGAAGTAGGG + Intergenic
1088527556 11:110773173-110773195 GAGTAGGCCTGCTGGAAGGAGGG - Intergenic
1089793193 11:120958952-120958974 GAGCAGACCTTGGGCATGGAGGG + Intronic
1090612125 11:128480547-128480569 AATCAGATCTGCAGGAAGGACGG + Intronic
1090950424 11:131468170-131468192 GAGCAGACAGACAGGAAGGGGGG - Intronic
1091079805 11:132655627-132655649 GAGCAAAGCTTCAGGCAGCATGG + Intronic
1091171667 11:133525324-133525346 GTGAAGCCCTTGAGGAAGGAGGG + Intronic
1091971915 12:4794455-4794477 CAGCAGACCTTCAGGAGGCCAGG - Intronic
1092170722 12:6372441-6372463 CAGCAGCCCTTCAAGAAGGAGGG + Intronic
1094042412 12:26132001-26132023 AAGCAGAGCTTCACCAAGGAAGG - Intronic
1094503170 12:31038136-31038158 GAGTAAACCATCAGGAAGGTGGG - Intergenic
1095800644 12:46267965-46267987 GGGCAGAGCACCAGGAAGGACGG + Intronic
1096081046 12:48832729-48832751 GAGCAGGTACTCAGGAAGGATGG - Intronic
1098579236 12:72079343-72079365 AAGTAGACCTTCAGTGAGGAGGG - Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1099490427 12:83282366-83282388 GCCCAGACCTTCAGGAATGAAGG - Intergenic
1100741627 12:97599890-97599912 GAGCATGCCTTCAGAAAGAAGGG - Intergenic
1103970302 12:124666652-124666674 GAGCAGAGAAGCAGGAAGGATGG + Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105916943 13:24925699-24925721 GAGCAGACCTTCTGAAAAGTCGG + Intergenic
1106690786 13:32113811-32113833 GCCCAGGCTTTCAGGAAGGAAGG - Intronic
1106863301 13:33934927-33934949 GAGCAGACCATCAGGAATGGGGG - Intronic
1107173133 13:37367201-37367223 GAACAGACCCGCATGAAGGAGGG - Intergenic
1108460914 13:50666546-50666568 ATTCAGACCTTCAGGAATGATGG + Intronic
1109516140 13:63444295-63444317 GTCCACACCCTCAGGAAGGAAGG + Intergenic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1114657766 14:24326226-24326248 GAGCAGACCCCCAGGGAGGATGG + Intronic
1116783623 14:49265018-49265040 AAGAAGACATTCATGAAGGAAGG + Intergenic
1119406922 14:74404832-74404854 CAGGATCCCTTCAGGAAGGATGG + Intergenic
1119568578 14:75649871-75649893 GAGCAGGCCGTTAGAAAGGAGGG - Exonic
1121105983 14:91280016-91280038 CTGCAGACTTTCAGGAAGGCTGG + Intronic
1121917465 14:97848866-97848888 AAGGAGACCTGCAGGGAGGAGGG - Intergenic
1122836470 14:104433208-104433230 GAGGAGGCCTTCAGGAAGGTGGG + Intergenic
1124208176 15:27740931-27740953 GAGCAGACCTGCAAGAAGCTTGG + Intergenic
1125766379 15:42139358-42139380 GAGCAGGCCTTCTGAAAGGTTGG - Exonic
1125796233 15:42406062-42406084 CAGCAGAAGCTCAGGAAGGAGGG - Intronic
1126168211 15:45671804-45671826 GAGTAGACCGGCAGGCAGGACGG - Intronic
1126714440 15:51499595-51499617 GAGCAAACCAACAGTAAGGATGG - Exonic
1128358544 15:66944792-66944814 GAGCAGGCTTTCAGGAAGCTGGG - Intergenic
1128718448 15:69927632-69927654 GAGCAGAGAGTCAGAAAGGAGGG + Intergenic
1129112240 15:73344197-73344219 CAGCTGACCCTCAGGGAGGATGG - Intronic
1129572293 15:76700598-76700620 GACCAGACCATCAAGAAGGCTGG - Intronic
1129695751 15:77739849-77739871 GCACAGACCTCCAGGAAGCAGGG - Intronic
1130770119 15:86915853-86915875 GAGCAGAGCTGCAGGAAAGCAGG + Intronic
1131177265 15:90217850-90217872 GAGCTGAGCTGCAGGAGGGATGG + Intronic
1131308879 15:91269773-91269795 TATCAGACCTTTGGGAAGGAAGG + Intronic
1131428079 15:92363465-92363487 GAGAACACATTCAGGAAGTATGG + Intergenic
1131784229 15:95894219-95894241 GATGAGACATTCAGGGAGGAAGG + Intergenic
1132615751 16:840458-840480 AAGCAGAGCTGCAGCAAGGAGGG - Intergenic
1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG + Intergenic
1136079911 16:27845079-27845101 GAGCAAAGCGTCAGGAAGTAAGG + Intronic
1136620371 16:31424367-31424389 GAGCAGAGCCTCAGAAAGGAGGG + Intronic
1137503243 16:49027614-49027636 GAGCAGAGCTCCAGGAACCAGGG + Intergenic
1138451245 16:57094332-57094354 GAGCAGACGTTCTGCAAGTAGGG + Intronic
1139992315 16:70950137-70950159 GAGGAGACCTGCAGGTTGGATGG - Intronic
1140121016 16:72082956-72082978 GAGGAGATCTTCGGGAAGGAAGG - Intronic
1141331958 16:83118928-83118950 GGGCTGACCTTGAGGAAGAAGGG - Intronic
1141484711 16:84330943-84330965 GAGCAGCCCTCCAGGGAGTAGGG - Intergenic
1141570908 16:84933104-84933126 GAGCAGCCCTCCAGCAAGGAAGG + Intergenic
1141918804 16:87120977-87120999 GGGAAGACTTTCAAGAAGGAGGG + Intronic
1142122999 16:88396488-88396510 GAGGAGACCCTCATGAAGGGAGG + Intergenic
1142123147 16:88396947-88396969 GAGGAGACCCTCATGAAGGGAGG + Intergenic
1143906631 17:10214367-10214389 GGGCAGAACTTCAGGAATTAGGG + Intergenic
1146682536 17:34818395-34818417 GAGCAGGCCTGCAGGAGTGAGGG - Intergenic
1150217424 17:63478165-63478187 GAGCAGCCCATCAGGGAGGGAGG + Intergenic
1150508790 17:65726412-65726434 CAGCAGAGCTTCATGGAGGAGGG + Intronic
1151235899 17:72719708-72719730 GAGCAGACCTTGGGGGAGGGAGG - Intronic
1151943104 17:77305079-77305101 GCGCAGATCTCCAGGAAGCAAGG - Intronic
1151954169 17:77372530-77372552 GAGCAGACGTTTCCGAAGGAAGG - Intronic
1152144490 17:78560111-78560133 GAGCCTACCTCCAGGCAGGAGGG - Intronic
1153924594 18:9824959-9824981 GAGAAGAGCGGCAGGAAGGACGG - Intronic
1153961976 18:10147733-10147755 GACCAGGACTTCAGGAATGAGGG - Intergenic
1155646200 18:28080948-28080970 GAGAAGACTTTCAAGATGGAAGG - Intronic
1156063174 18:33106258-33106280 GAGGAAACTTGCAGGAAGGAAGG - Intronic
1157532756 18:48435690-48435712 GAGAAGAATTGCAGGAAGGAAGG + Intergenic
1157616629 18:48991246-48991268 GAGCTCTCCTCCAGGAAGGAGGG + Intergenic
1157972459 18:52285941-52285963 CAGCAGAACACCAGGAAGGAGGG + Intergenic
1159712080 18:71773534-71773556 GGGCAGACATTGAGGAAAGAGGG - Intronic
1164430160 19:28180604-28180626 GAGCAGAACTGCAGGAAATAGGG + Intergenic
1164573805 19:29393479-29393501 GAACAGACAAGCAGGAAGGAGGG + Intergenic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1164971905 19:32539815-32539837 GAGCAGACCCTAGGCAAGGAGGG + Intergenic
1165278938 19:34780514-34780536 GAGAAGAAATTAAGGAAGGAAGG + Intergenic
1166629841 19:44396643-44396665 GGGCAGCCCCTCAGGAAGGGTGG - Intronic
1166637614 19:44464775-44464797 GGGCAGCCCCTCAGGAAGGGTGG + Intergenic
1166752192 19:45169640-45169662 GAGGAGAACCCCAGGAAGGAAGG + Intronic
1168386493 19:55967637-55967659 GAGCAGAGCTACAGCAAGCATGG + Intronic
925347959 2:3183629-3183651 GAGCAGGCCTTCAGCAGGGCGGG - Intergenic
925412975 2:3650617-3650639 GAGCAGAGCATCTGGAAGGGAGG - Intergenic
925444277 2:3914494-3914516 TAGCAGTCATTCAGGAGGGAGGG - Intergenic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
926703293 2:15818526-15818548 GAGGGTACCTCCAGGAAGGACGG + Intergenic
927148725 2:20183758-20183780 AATCAGAGCTTCAGGAAGGCTGG - Intergenic
928572163 2:32620492-32620514 GAGAAGTCCTTGGGGAAGGATGG + Intergenic
928748427 2:34442964-34442986 GAGCACCTCTTCAGGAAGGAGGG - Intergenic
929558072 2:42937730-42937752 GAGCAGGCTTTCAAGAAGGAAGG - Intergenic
930036803 2:47090964-47090986 GAGCAAACTTTGAGGAAGGAGGG + Intronic
930063605 2:47310902-47310924 GAACTGACCTTCAGAAGGGAGGG - Intergenic
930308625 2:49709310-49709332 GATCAGAGTTTCAGGAGGGAGGG - Intergenic
932396842 2:71454440-71454462 GACCAGACCTTCAGGGGAGAAGG - Intronic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932462355 2:71891216-71891238 GAGCTGACCTCCAGGATAGATGG + Intergenic
933816322 2:86071855-86071877 GAGGAGCCCTTCAGGATGCATGG - Intronic
934500790 2:94858539-94858561 GAGCAGACCTTCAGGTCTGGTGG - Intergenic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
935660877 2:105465894-105465916 GAGCAGAGCCTCTGGCAGGATGG + Intergenic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
937419089 2:121739679-121739701 GATTCCACCTTCAGGAAGGAGGG - Intronic
938468743 2:131541416-131541438 GAACACACATTCGGGAAGGAAGG + Intergenic
938543916 2:132309857-132309879 GGGCAGTCCCTCAGGAAGGGTGG + Intergenic
938617288 2:133012627-133012649 GAGCAAAACTTCAGGAGGGAAGG - Intronic
943104506 2:183527908-183527930 GAGAAGATCATCAAGAAGGAAGG + Intergenic
943263778 2:185699116-185699138 GGCCAGACTTTCAGGAATGAAGG + Intergenic
944413173 2:199461931-199461953 GAGCGGGCCTCTAGGAAGGAAGG - Intronic
944699123 2:202230413-202230435 GAAAAGACCTGAAGGAAGGAAGG - Intronic
946313332 2:218894922-218894944 GAACAGACCCTCAAGGAGGAGGG + Intronic
946378651 2:219329757-219329779 GAACAGACCTGCAGGATGAAAGG + Exonic
946894548 2:224310025-224310047 GAGCATGCCGTGAGGAAGGAGGG - Intergenic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948253131 2:236546599-236546621 GAGTAAAGCTTCAGGCAGGAGGG - Intergenic
1169191610 20:3661841-3661863 GAGCAGGAGGTCAGGAAGGAGGG - Intronic
1169644104 20:7790071-7790093 AAGCAGACCTTCAGAAATTATGG - Intergenic
1169804719 20:9547692-9547714 AAGCATCCCTTCAGGAGGGATGG + Intronic
1170756549 20:19211534-19211556 GCCCACACCTTCAGCAAGGAGGG + Intergenic
1172873360 20:38149286-38149308 GATGAGACCTAGAGGAAGGAAGG - Intronic
1173401626 20:42731076-42731098 GAGAAGACCTACAGAATGGAAGG + Intronic
1173826553 20:46051552-46051574 GAGCTGAGCTTCAGGAAGATTGG + Intronic
1174114947 20:48220445-48220467 GAGCAGCCCTGGACGAAGGAAGG + Intergenic
1174225264 20:48993692-48993714 CAGCTGAGCTTCAGGTAGGAGGG + Intronic
1174373827 20:50112639-50112661 GAGAAGCCCTTCAGGCTGGATGG - Intronic
1174556292 20:51397915-51397937 GATGAGACATTGAGGAAGGAAGG - Intronic
1174755198 20:53151511-53151533 GATAATATCTTCAGGAAGGAAGG + Intronic
1175647869 20:60691113-60691135 AATCAGAGCTTCAGGAAGGAAGG + Intergenic
1176667974 21:9705315-9705337 GAACAGACGCTCAGGAAGGCGGG - Intergenic
1178178124 21:30128506-30128528 GAGTAGACATTCAGGAAGAAAGG - Intergenic
1178668826 21:34572467-34572489 GAGCAGCCCCTCATGAAGTAGGG - Intronic
1179390697 21:40987737-40987759 GCACATACCTTCAGGAGGGAAGG + Intergenic
1179627198 21:42655390-42655412 GAGGAGAGCTTCAGGAGGGGTGG + Intronic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1180981136 22:19878549-19878571 GACCAGACCTTCAGGCCAGATGG - Intronic
1181042587 22:20199241-20199263 CAGCAGAGCTCCTGGAAGGAAGG + Intergenic
1181582857 22:23837555-23837577 GAGGAGAACTCCAGCAAGGATGG + Intronic
1183054450 22:35294837-35294859 GAACAGACCAGGAGGAAGGAAGG - Exonic
1183151684 22:36042566-36042588 GAGCAGACCTTACCCAAGGAGGG + Intergenic
1184822338 22:46918585-46918607 GGGGACAACTTCAGGAAGGAGGG + Intronic
1203289544 22_KI270735v1_random:21033-21055 GAGCAGATCTCAAGGAAGCAAGG - Intergenic
949720982 3:6990057-6990079 GCACAGCCCTTCAGGAAGGGAGG - Intronic
949895493 3:8765020-8765042 GACCAGACCTTCAGTAGAGACGG - Intronic
950576895 3:13837425-13837447 GAGCTGACATTCAGGAGGGGAGG - Intronic
950883137 3:16339288-16339310 GAGCAGAGCATAAGGAGGGAGGG - Intronic
951328352 3:21333287-21333309 AAGCTGACCTTCAGAAATGAGGG + Intergenic
951430819 3:22604920-22604942 CTGCAGACCATCAGGAAGGGAGG + Intergenic
951519912 3:23601871-23601893 GAAAAGAAGTTCAGGAAGGAGGG - Intergenic
952444094 3:33363592-33363614 GACCAGACCTTCAGGAATAAAGG - Intronic
952818196 3:37463707-37463729 GAGCAGGGATACAGGAAGGATGG + Intronic
953240935 3:41148917-41148939 GAGCAGCCCACCAGGGAGGAAGG + Intergenic
953414341 3:42707068-42707090 GAGGTGATCTTGAGGAAGGATGG + Intronic
953420222 3:42748469-42748491 CAGCTGAACTTCAGGAAGCAGGG + Intronic
953855614 3:46497374-46497396 GAGAACCCCCTCAGGAAGGAGGG + Intergenic
955112526 3:55963055-55963077 CAGAAGAGCTTCAGGATGGAAGG + Intronic
955376119 3:58398578-58398600 GAGAGCACCTTTAGGAAGGAGGG + Intronic
957840426 3:85661489-85661511 GAGAAGAACATCAGGAAGCAAGG - Intronic
959089265 3:101885034-101885056 GACCACACCTTCAGGTAGTATGG + Intergenic
960926893 3:122803310-122803332 GAGAAGAGCTTCAGGAAGGTAGG + Intronic
961307098 3:125965862-125965884 GAGCAGACCATCGGAAGGGAAGG + Intergenic
962036387 3:131656088-131656110 AAGCACTCCTTCAGGAATGAGGG - Intronic
962936617 3:140087215-140087237 TTGCTGAACTTCAGGAAGGAGGG + Intronic
962936806 3:140089084-140089106 TAGCAGGTCTTCAGGAAAGAGGG - Intronic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
965562745 3:170077455-170077477 GAGCAGGCCTTCTGAAAGGTCGG + Intronic
965562934 3:170078872-170078894 GAGCAGGCCTTCTGGAAGGCCGG + Intronic
966221173 3:177552712-177552734 GAGCTGACGTACAGGGAGGAGGG + Intergenic
967298923 3:187993191-187993213 GATCACTCCTTCAGAAAGGACGG - Intergenic
968686654 4:1964070-1964092 GAGCAGACCTTCCTAATGGAAGG + Intronic
969132926 4:5004762-5004784 CAGCACACCTTGAGGAGGGATGG + Intergenic
969416874 4:7066667-7066689 GAGCTGACCTGCAGAAAGGCTGG - Intronic
969475418 4:7419976-7419998 GTGCAGAGCTACAGGATGGAAGG - Intronic
969610714 4:8226381-8226403 GACCATCCCTGCAGGAAGGATGG - Intronic
969637731 4:8379044-8379066 GAGAACACCCCCAGGAAGGAAGG - Intronic
969933516 4:10658042-10658064 GAGCTGACCTTGAGGAACAATGG - Intronic
970328544 4:14954786-14954808 GAGCTCTCCATCAGGAAGGATGG - Intergenic
971370577 4:26015622-26015644 GAGAAGACCATTAGGAAGGAGGG + Intergenic
972105724 4:35483634-35483656 TAGATGACTTTCAGGAAGGATGG - Intergenic
972749805 4:41977360-41977382 GAGCAGACTTTAGAGAAGGAAGG - Intergenic
974109727 4:57511868-57511890 AAGCAGACCTACAGGAAAGTGGG - Intergenic
974640660 4:64625522-64625544 GAGCAGGCCTTCTGAAAGGTTGG - Intergenic
977318753 4:95484145-95484167 AAGCAGACCTACAGGAAGTCAGG + Intronic
977708246 4:100095211-100095233 GAGCTGAACTACAGCAAGGATGG + Intergenic
979278234 4:118836386-118836408 GCGCAGCCCCGCAGGAAGGAGGG + Intronic
980158376 4:129132939-129132961 GAGCAGGTCTTATGGAAGGAAGG + Intergenic
982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG + Intergenic
982699305 4:158641545-158641567 GAGCAGAACATGAGGAAAGAAGG - Intronic
982716163 4:158810846-158810868 GAGCAGAACTTGAGGAAAAAAGG - Intronic
983820246 4:172184117-172184139 TAGCAGACATTCTTGAAGGATGG + Intronic
984587034 4:181576623-181576645 CAGCAGAACCACAGGAAGGAAGG + Intergenic
985076954 4:186225209-186225231 AAGCTGTCCTTCAGAAAGGAAGG - Intronic
985122438 4:186657519-186657541 GAGGAGACCTTTGGGAATGATGG + Intronic
986531110 5:8737986-8738008 AAGAAGAATTTCAGGAAGGAAGG + Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
990580326 5:57161772-57161794 GATCACTGCTTCAGGAAGGAAGG + Intergenic
991497098 5:67237274-67237296 GCAAAGACCTTCAGGATGGAAGG + Intergenic
991509456 5:67360687-67360709 GGGGAGAGCTTCAAGAAGGAAGG + Intergenic
992190220 5:74284682-74284704 GAACAGAGCATCAGGAAGCAGGG - Intergenic
994455212 5:99997232-99997254 AACCAGACCTTCAGGCAGCATGG - Intergenic
995516181 5:112956154-112956176 AATCAGAACTTCAGTAAGGAGGG + Intergenic
997109162 5:131055690-131055712 AAGCAGTCCTTCATGAATGAGGG + Intergenic
997666575 5:135634326-135634348 GAGAAGCCATTCAGGAGGGAAGG + Intergenic
998477887 5:142436712-142436734 GAGCTGCACTTCAGGAAGGTGGG - Intergenic
999229695 5:150054362-150054384 GAGCAGATCTGCTGGAAGGTGGG + Exonic
999284419 5:150385747-150385769 CATCAGACCTACAGGTAGGAGGG + Intronic
999682123 5:154070232-154070254 GAGCAGGCCTTCTGAAAGGTTGG - Intronic
1000047757 5:157535591-157535613 AACAAGACCTTCTGGAAGGAGGG + Intronic
1000836600 5:166162189-166162211 GAGCAGGACTTCATGAAGGAAGG - Intergenic
1001020821 5:168181008-168181030 GAGCACACCTTCAGCAACGCTGG + Intronic
1001124579 5:169007951-169007973 GACCAGACCTCCAGGCAGGCTGG - Intronic
1001839880 5:174866103-174866125 CAGCAAACCCTGAGGAAGGAAGG - Intergenic
1002450858 5:179317809-179317831 GAGCAGACGTACAGGATGGAGGG + Intronic
1002690121 5:181044717-181044739 GAGCAGAGCATCAGGAGTGAGGG + Intronic
1003064407 6:2891068-2891090 GAGCATAGTTTCAGGAAGGTGGG + Intronic
1005987234 6:30882845-30882867 GAGCACAGCTCCTGGAAGGAGGG + Intronic
1007722013 6:43890757-43890779 TAGCAGACCTGGAGGAGGGAAGG - Intergenic
1009688074 6:66989353-66989375 AAGCTGTCCTTCAGAAAGGAGGG - Intergenic
1010107694 6:72188700-72188722 GCCCAGACCCTCAGGAATGATGG - Intronic
1011830301 6:91363805-91363827 GCCCAGACCTTCAGGAATGAAGG + Intergenic
1014315816 6:119863322-119863344 GAGCTGAGCTACAGTAAGGAAGG - Intergenic
1015707965 6:136108915-136108937 GAAGAGAGATTCAGGAAGGAAGG - Intronic
1015852435 6:137588417-137588439 AAGCAGACCTTCAGAATGGTAGG + Intergenic
1016086154 6:139917952-139917974 GAGCATAACTTCATGGAGGAGGG - Intergenic
1018092491 6:160357034-160357056 GAGCAGATGTTAAGGAAGGTGGG - Intronic
1018947238 6:168356432-168356454 GTCCAGACCTGCAGGAAAGAAGG - Intergenic
1019847809 7:3524096-3524118 GCAAAGACCTGCAGGAAGGAAGG + Intronic
1020569541 7:9841776-9841798 GAGCAGAGCTGTTGGAAGGAAGG + Intergenic
1020830068 7:13084323-13084345 GAGAAGACTTTTAGGAAAGAAGG - Intergenic
1021630814 7:22645488-22645510 AAGCTGACCTTCAGAAATGAAGG - Intergenic
1021841653 7:24726094-24726116 GAGCAGCCCAGCAGGAAGGGAGG + Intronic
1022531636 7:31070396-31070418 GAGCAGACTTGGAGGGAGGAGGG + Intronic
1022685078 7:32589512-32589534 GAGAAGCCCTTCATGAAGGATGG - Intergenic
1023242141 7:38160030-38160052 GAGCAGGCCTTCTGAAAGGTTGG + Intergenic
1023808322 7:43890852-43890874 CAGCAGACCTGCCGGAAGTAGGG - Intronic
1025851757 7:65250134-65250156 GACCAGAACTACAGGAGGGAAGG + Intergenic
1026677617 7:72441249-72441271 GAGCAGACCTACAGGGAGGTGGG + Intronic
1026808302 7:73441883-73441905 GAGCAGGCCCTTAGGAAAGAAGG + Intronic
1026940303 7:74283908-74283930 GAGCAGCCCTGCAGGAATCAGGG + Intergenic
1028187675 7:87807229-87807251 GAACAGAACTACAGCAAGGATGG - Intronic
1029248316 7:99218470-99218492 GGGGAGTACTTCAGGAAGGAGGG + Intergenic
1032463730 7:132130301-132130323 GAGAAGAGATCCAGGAAGGAGGG + Exonic
1032502710 7:132411969-132411991 GGACAGACCTTCATGAAGGGAGG - Intronic
1032527305 7:132588614-132588636 GAACACACCTTGAGGAAGGAAGG + Intronic
1032799632 7:135307677-135307699 GAGCAGACCATCTACAAGGAGGG + Intergenic
1032923614 7:136577220-136577242 GAGGTCACCTTGAGGAAGGATGG + Intergenic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1034516609 7:151585845-151585867 GAGCAGAAGTACAGGAAGGGAGG + Intronic
1035319937 7:158022300-158022322 GTGGAGGCCGTCAGGAAGGATGG - Intronic
1036066901 8:5390651-5390673 GGGCAGGCCTTGGGGAAGGAAGG + Intergenic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1037177321 8:15962307-15962329 GACCAGACCATCAAGAAGGCTGG - Intergenic
1037943741 8:22973815-22973837 GAAGAGGCCTCCAGGAAGGAGGG - Intronic
1038957744 8:32485572-32485594 AAGCAGACACTCAAGAAGGAAGG + Intronic
1039404783 8:37303167-37303189 GAGCAGACAGGCACGAAGGAGGG + Intergenic
1039469630 8:37805192-37805214 GGGCAGAGCTCCAGGATGGAGGG - Intronic
1040565433 8:48562923-48562945 AAGCTCACCTTCAGGAGGGAAGG - Intergenic
1041253765 8:55961028-55961050 GAAGAGACCCTGAGGAAGGAAGG + Intronic
1041643856 8:60230611-60230633 GAGCAAAATTTCAGGAAGGAAGG - Intronic
1041740472 8:61151841-61151863 GATCAGAAATTCAGCAAGGAAGG - Intronic
1042762635 8:72287289-72287311 TAGCAGACCTGCAGGTAAGACGG - Intergenic
1042963934 8:74330817-74330839 GAGCTTCCCTTCAGGAAGAAAGG + Intronic
1045004530 8:97906458-97906480 GAACAGACCATCTGGTAGGAGGG - Intronic
1045683350 8:104686302-104686324 CAGCCTTCCTTCAGGAAGGAAGG - Intronic
1047663051 8:127059521-127059543 AAGCAGACCTGCAGTAAAGAGGG + Intergenic
1049090328 8:140509791-140509813 GAGCTGACCTTCAGGTCTGAGGG - Intergenic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1051095940 9:13465282-13465304 GAGCATATCTACAGGATGGAAGG - Intergenic
1051216486 9:14803372-14803394 GAGAAGACTATGAGGAAGGAAGG - Intronic
1051368463 9:16338084-16338106 GAAAAGACTTTCAGGAAGAAGGG + Intergenic
1051775246 9:20624880-20624902 GAGCATTCTTTGAGGAAGGAGGG - Intergenic
1052875932 9:33563582-33563604 GAGAAGGCCATCAGTAAGGATGG + Intronic
1053416385 9:37949468-37949490 GTGCAGACCTGCAGGAGGCAAGG + Intronic
1053500077 9:38580779-38580801 GAGAAGGCCATCAGTAAGGATGG - Intergenic
1054926362 9:70592630-70592652 GGGCATCCCTTCAGGAAGTATGG - Intronic
1054926891 9:70598525-70598547 GACCAGCCCTTCAGGAGTGACGG - Exonic
1056512012 9:87315238-87315260 GAGCTGACCTGCAGGAGTGAGGG - Intergenic
1057081233 9:92176128-92176150 CAGCAGGCTTGCAGGAAGGATGG + Intergenic
1057130576 9:92651573-92651595 GACCTGAGCTTCAGGAGGGAGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057503083 9:95611225-95611247 GACAAGACGTTCTGGAAGGAGGG + Intergenic
1057611917 9:96552187-96552209 CAGTGGACTTTCAGGAAGGAGGG - Intronic
1057678668 9:97155186-97155208 GGGCACACATGCAGGAAGGAAGG - Intergenic
1057835148 9:98438404-98438426 GAGGAGACATTCAAGAAGTAGGG + Intronic
1058185111 9:101845659-101845681 GAGCAGGGCTTTAGAAAGGAAGG - Intergenic
1058319694 9:103613736-103613758 AAGCAGTCCTTCAGAAATGAGGG - Intergenic
1203657860 Un_KI270753v1:15496-15518 GAACAGACGCTCAGGAAGGCGGG + Intergenic
1186104432 X:6191261-6191283 GGGTAGAACTTCAGTAAGGAGGG + Intronic
1189332580 X:40152747-40152769 AAGCAGACATTCAGTGAGGAGGG - Intronic
1190996498 X:55615606-55615628 GCCCAGACCTTCGGGAATGAAGG - Intergenic
1191171287 X:57449678-57449700 GAGCAAAACTCCAAGAAGGAAGG - Intronic
1192659806 X:73030359-73030381 TAGCAGATCTTCAAGAGGGAAGG + Intergenic
1196764955 X:119235287-119235309 AAGCAGACCTCCACGGAGGAAGG - Intergenic
1197146626 X:123179260-123179282 GAGCAGGCCTTCAGGAAGACAGG + Intergenic
1199390423 X:147271609-147271631 GAACAGACCTTCTGAAAGGCGGG + Intergenic
1200071276 X:153530653-153530675 GGGCAGAGCTTCAGGCAGGTGGG + Intronic
1201187178 Y:11415838-11415860 AAGAAGACCCTGAGGAAGGAAGG - Intergenic
1201400079 Y:13595594-13595616 GACCAGACCTTTAAGAATGAAGG - Intergenic