ID: 1036767650

View in Genome Browser
Species Human (GRCh38)
Location 8:11558895-11558917
Sequence TACTGGGTAAGGCTGGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036767650_1036767661 25 Left 1036767650 8:11558895-11558917 CCCTCGCCCAGCCTTACCCAGTA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1036767661 8:11558943-11558965 AACGCCTTTTTCCGCTGAGGTGG No data
1036767650_1036767662 26 Left 1036767650 8:11558895-11558917 CCCTCGCCCAGCCTTACCCAGTA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1036767662 8:11558944-11558966 ACGCCTTTTTCCGCTGAGGTGGG No data
1036767650_1036767655 -10 Left 1036767650 8:11558895-11558917 CCCTCGCCCAGCCTTACCCAGTA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1036767655 8:11558908-11558930 TTACCCAGTAGCGCCGCTGCAGG No data
1036767650_1036767660 22 Left 1036767650 8:11558895-11558917 CCCTCGCCCAGCCTTACCCAGTA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1036767660 8:11558940-11558962 CACAACGCCTTTTTCCGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036767650 Original CRISPR TACTGGGTAAGGCTGGGCGA GGG (reversed) Intronic
900936297 1:5768356-5768378 TACTGGGTTAGGGTGGGCCGTGG - Intergenic
902249220 1:15142415-15142437 CACTGGGGGAGGCTGGGTGAAGG - Intergenic
902513409 1:16978020-16978042 TGCTGTGGAAGGCTGGGGGAAGG + Intronic
902727553 1:18347210-18347232 TCCTGGGTGAGGGTGGGCTATGG - Intronic
903465644 1:23550876-23550898 TTCTGGGTCAGGCTGAGCCAGGG + Intergenic
907487217 1:54786488-54786510 TACTTTGTAAGGTTGGGGGATGG - Intronic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
914698124 1:150104698-150104720 TACTTGGTGAGGCTGGGGGCAGG - Intronic
915227724 1:154423022-154423044 TACAGGGGAGGGCTGGGCTATGG + Intronic
917480006 1:175403671-175403693 TGCTGGGGAAGGATGGGCAAAGG + Intronic
918295317 1:183150633-183150655 TATTGGGGGAGGCTGGGTGAAGG - Intergenic
918438510 1:184541985-184542007 TTCTGGGAAAGGAAGGGCGAAGG + Intronic
918770756 1:188556667-188556689 TACTGATTCAGGCTGGGTGAGGG + Intergenic
919807295 1:201387719-201387741 TGCCGGGCAAGGCTGGGGGAGGG + Intronic
919807552 1:201389292-201389314 TGCCGGGCAAGGCTGGGGGAGGG + Exonic
921179224 1:212618703-212618725 TACTGGCTAAGCCAGGGAGAAGG - Intronic
1064540846 10:16403514-16403536 CACTGGGTAACTCTGGGCAAGGG + Intergenic
1064626349 10:17265926-17265948 TAGTGGGATAGGCTTGGCGAGGG + Intergenic
1065229103 10:23578776-23578798 TACTGGGCAAGACTGGGTGTGGG + Intergenic
1065750331 10:28880016-28880038 CACTGAGTGAGGCTGGGAGAGGG + Intronic
1069605671 10:69737340-69737362 TACTGGGTCAGGCTGGGGGTTGG - Intergenic
1071240577 10:83700638-83700660 TATTAGGTAGGGCTGGGGGAGGG - Intergenic
1073457766 10:103647891-103647913 CACTGGTTAAGGCAGGGGGAGGG + Intronic
1074434684 10:113424095-113424117 TGCTGGGGAAGGCTGGCCAATGG + Intergenic
1076373008 10:129967024-129967046 TTCTGGGGAAGGCGGGGCGCTGG + Intergenic
1084357744 11:68651226-68651248 CACTGGGTGAGGATGGGCGCTGG - Intergenic
1085409214 11:76281666-76281688 TTCTGGGCAAGGCTGGGCAGGGG + Intergenic
1085699635 11:78734685-78734707 GACTGGGTAAGGCTGTGTGGGGG - Intronic
1091964012 12:4722788-4722810 TTCAGGGTGAGGCTGGGAGATGG + Intronic
1092030950 12:5284654-5284676 TAGTGGGGAAGTCTGGGAGAGGG - Intergenic
1092124251 12:6064594-6064616 GACTGGGCCAGGCTGGGAGAAGG - Intronic
1095956924 12:47812188-47812210 CACTGGGAGAGGCTGGGAGAGGG + Intronic
1100715846 12:97304314-97304336 TTCTGGGAAGGGCTGGGAGATGG + Intergenic
1102011033 12:109618506-109618528 TACTGGCTGAGGCTGGGCAGGGG - Intergenic
1103609796 12:122116195-122116217 CACTGGGGAAAGCTGGGTGAAGG + Intronic
1104224253 12:126815610-126815632 CACAGGGTAAGGCAGGGTGAGGG - Intergenic
1110926316 13:81157944-81157966 TACTGGGATAGGCTGGGAGTAGG + Intergenic
1118671592 14:68133885-68133907 CACTGGGGAAGGCTGGGTGAAGG - Intronic
1123442485 15:20302091-20302113 CACAGGGTAAGGCAGGGCAATGG - Intergenic
1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG + Intronic
1125505411 15:40265146-40265168 CCCTGGGTAAGCCAGGGCGAAGG + Intronic
1128156908 15:65396817-65396839 TGCTGGGTGAGGCGGGCCGAAGG - Exonic
1128767493 15:70260022-70260044 CACTGGGTAGGGCTGGGGTAAGG + Intergenic
1129656805 15:77529950-77529972 GACTGGGCCAGGCTGGGTGAAGG - Intergenic
1130104485 15:80919297-80919319 CACTGAGTAAGGGTGGACGAGGG - Intronic
1136718732 16:32303453-32303475 CATTGGGTAAGGCAGGGCAATGG + Intergenic
1136837103 16:33509717-33509739 CATTGGGTAAGGCAGGGCAATGG + Intergenic
1137753015 16:50880515-50880537 ACCTGGGTAAGGCTGGAGGAGGG + Intergenic
1137827343 16:51510602-51510624 TACATGGAAAGGCTGGGGGATGG + Intergenic
1139596252 16:67960042-67960064 CACAGGGTAAGGATGGGAGAGGG - Intronic
1140437160 16:74956889-74956911 GATTGGGAAAGGCTGGGAGAAGG - Intronic
1141483416 16:84322386-84322408 TCCTTGGTAAGGCTGGGACAAGG - Intronic
1141528891 16:84632182-84632204 AACTGGGGAAGGCTGGGTGGAGG - Intergenic
1203007699 16_KI270728v1_random:214318-214340 CATTGGGTAAGGCAGGGCAATGG - Intergenic
1203123720 16_KI270728v1_random:1559270-1559292 TGCAGGGTAAGGCAGGGCAATGG - Intergenic
1203147280 16_KI270728v1_random:1809996-1810018 CATTGGGTAAGGCAGGGCAATGG + Intergenic
1145825696 17:27875703-27875725 TAATGAGAAAGGCTGGGAGATGG - Intronic
1147360009 17:39924528-39924550 TAGGGGGTGAGGCTGGGGGATGG - Intronic
1147691036 17:42314609-42314631 TAGTGAGTAAGGCTGGGCAGAGG - Exonic
1147794076 17:43030287-43030309 AACTGGCTAGGGCTGGGGGAGGG - Intergenic
1149468172 17:56895581-56895603 TGCTGGGTAAGGCAGGGACAGGG + Exonic
1149917876 17:60628281-60628303 TAGTGGGGAAGCCTGGGAGACGG - Intronic
1150435660 17:65152262-65152284 TCCTTGGTATGGCTGGGGGAAGG + Intronic
1150916272 17:69440397-69440419 TATTGGGTGAGGCTGGGGTAGGG - Intronic
1151418664 17:73983505-73983527 TTGTGGGCAGGGCTGGGCGAGGG - Intergenic
1151668840 17:75560379-75560401 TACAGGGTGAGGCTGGGCACTGG - Intronic
1151763597 17:76121401-76121423 TAGGGGCTAAGGCTGGGCTAGGG - Intronic
1153848635 18:9072404-9072426 TACTGGGGAAGGCTGGGGAAGGG - Intergenic
1158647906 18:59264228-59264250 GACTGGGCAAGGCTGGGAGTGGG + Intergenic
1163544587 19:17933489-17933511 GAGTGGCTCAGGCTGGGCGAGGG - Intronic
927629069 2:24755323-24755345 TTCTGTGTAAGGCTGGTTGATGG + Intronic
929607703 2:43246136-43246158 TTCTGGATAAGGCTGGGAGGTGG - Intronic
933814420 2:86054193-86054215 CACTGGGAAAGCCTGGGTGAAGG - Exonic
936377638 2:111955679-111955701 CATTGGGTAAAGCTGGGTGAAGG + Intronic
941646114 2:168043084-168043106 GACTGGGTAAAGTTGGGCGGTGG - Intronic
947488753 2:230575905-230575927 TAATCGGTAAGGCTGGTGGAGGG - Intergenic
948468967 2:238165390-238165412 TATTGGGAAAGGCAAGGCGAGGG - Intronic
1168861132 20:1046736-1046758 TTCAGGGAAAGGCTGGGCTATGG - Intergenic
1170652492 20:18255723-18255745 TATTGGGTAAAGCTGGTCCAAGG - Intergenic
1171494979 20:25548983-25549005 CCCTGGGTGAGGCTGGGCGTAGG - Intronic
1172834550 20:37864587-37864609 TTCTGGGGAAGGCTGGACGTCGG - Intronic
1173200528 20:40951500-40951522 TTCTGGGTAAGGGTGGGGGTAGG + Intergenic
1173250347 20:41361192-41361214 TGCTGGATAAGGCTGGGCTCTGG + Exonic
1175429572 20:58891860-58891882 TGCTGGGTAAGGGCGGGCGGGGG + Intronic
1176260627 20:64177712-64177734 TGCTGGGAAAGGCTGGGGGCAGG + Intronic
1180549125 22:16527626-16527648 TGCAGGGTAAGGCAGGGCAATGG - Intergenic
1181265151 22:21626767-21626789 TGCTGGCTAAGGCTGGGAGAGGG - Intergenic
1181561481 22:23705005-23705027 TAATGTGTAAGACTGGGCAAAGG - Intergenic
1181737049 22:24890387-24890409 CACTGGGGAAAGCTGGGTGATGG - Intronic
1183001032 22:34859247-34859269 TTCTGGGTAAGGCTGGGGCTGGG + Intergenic
1184172551 22:42768561-42768583 TACTTGCTAAGGCTGGGCCCTGG + Intergenic
951630556 3:24715582-24715604 CACTGGGGGAGGCTGGGTGAAGG - Intergenic
953347088 3:42185207-42185229 TCCTGAGTCAGGCTGGGCGTGGG + Intronic
956336218 3:68166871-68166893 TACTGGGTAAGGCTTCACGGCGG - Intronic
959081332 3:101804370-101804392 TCCTGGGTGAGGCTGGTTGATGG + Intronic
960677109 3:120205848-120205870 TATTGGGGAAAGCTGGGCGAAGG - Intronic
961009192 3:123424638-123424660 TTCTGGGTAAGGCTGGAGGAAGG - Intronic
968076979 3:195821364-195821386 TAAGGGGTAAGGGTGGGAGAGGG + Intergenic
969347919 4:6580750-6580772 TACTGGGCAAGGCTGGGCAAGGG + Intronic
969630480 4:8333021-8333043 CCCTGGGTAGGGCTGGGCCATGG - Intergenic
970310381 4:14776712-14776734 TAAGGGGGAAGGCTGGGCGAGGG - Intergenic
970816079 4:20157355-20157377 TGCTGGCTGAGGCTGGGGGAAGG - Intergenic
972388650 4:38592061-38592083 TACTGCATGAGGCTGGGGGAGGG - Intergenic
987699129 5:21372896-21372918 TCCTGTGTAAGCCTGGGCTAGGG - Intergenic
988753293 5:34215263-34215285 TCCTGTGTAAGCCTGGGCTAGGG + Intergenic
991741072 5:69676110-69676132 TCCTGTGTAAGCCTGGGCTAGGG + Intergenic
991756546 5:69878332-69878354 TCCTGTGTAAGCCTGGGCTAGGG - Intergenic
991792646 5:70255847-70255869 TCCTGTGTAAGCCTGGGCTAGGG + Intergenic
991820532 5:70552183-70552205 TCCTGTGTAAGCCTGGGCTAGGG + Intergenic
991835948 5:70754245-70754267 TCCTGTGTAAGCCTGGGCTAGGG - Intergenic
991885096 5:71256155-71256177 TCCTGTGTAAGCCTGGGCTAGGG + Intergenic
997528853 5:134570106-134570128 TACTGGGTGAGGCTCTGCCAGGG - Intronic
997932522 5:138084071-138084093 CACTGGGGTAGGCAGGGCGATGG + Exonic
998146707 5:139733398-139733420 AAGTGGGCAAGGCTGGGCCATGG - Intergenic
998174917 5:139895846-139895868 TACTGGGGAAAGCTGGGCTCTGG + Intronic
998509018 5:142695995-142696017 AACTGGGCAAGGGTGGGTGAGGG + Intronic
999935467 5:156481295-156481317 TATTGGGGAAGGCTGGGAGATGG + Intronic
1001272908 5:170328989-170329011 TGCTGGGTACTGCTGGGCTAAGG - Intergenic
1001382702 5:171314790-171314812 GGCTGGGCAAGGCTGGGTGAGGG - Intergenic
1001449833 5:171816140-171816162 TAATGGGTATGTCTGGGAGAGGG - Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002670383 5:180861487-180861509 TTCTGGGGTAGGCTGGGGGAGGG + Intergenic
1003495826 6:6662354-6662376 TCCTGATTAAGGCTGGGGGATGG - Intergenic
1004259555 6:14096178-14096200 CACTGGGTAGGGGTGGGTGAAGG + Intergenic
1004938833 6:20534569-20534591 TTCTGGGTAAGGGTGGCCGATGG + Exonic
1005551461 6:26922086-26922108 TCCTGTGTAAGCCTGGGCTAGGG + Intergenic
1005994473 6:30922971-30922993 TTCAGGGTAAGCCTGGGCGAGGG + Exonic
1006105468 6:31713744-31713766 CACTGGGTAAGGGTGGGCTGGGG - Exonic
1006360883 6:33586448-33586470 TCCTGGGGAAGGCAGGGCGAAGG + Intergenic
1012448306 6:99328763-99328785 TAATGGTTAATGCTGGGGGAGGG - Intronic
1017074738 6:150607179-150607201 TCCTGGCTAAGGCTGGACCATGG - Intronic
1017168616 6:151434359-151434381 TTCTGGTAAAGGCTGGGTGATGG + Intronic
1020402859 7:7797596-7797618 TACTGGGTGAGGATGGTTGAGGG - Intronic
1021969108 7:25950526-25950548 TACTGGGAATGGCTGGGGAAGGG - Intergenic
1024350354 7:48357049-48357071 TGCTGGGTCAGGCTGAGTGATGG + Intronic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028983426 7:96992245-96992267 TCCTGGTTAAGGCTGGATGAGGG + Intergenic
1030779937 7:113587864-113587886 TAGTGGGGAAGGCTGGGGTAGGG - Intergenic
1035326220 7:158067828-158067850 CACTGGGTCACGCTGGGCCATGG + Intronic
1035413782 7:158667367-158667389 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413854 7:158667569-158667591 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413913 7:158667741-158667763 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413924 7:158667771-158667793 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413945 7:158667830-158667852 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035414014 7:158668032-158668054 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035414074 7:158668204-158668226 TAGTGGGTAAGGGGGGGCGGAGG - Intronic
1035712478 8:1729302-1729324 GAGTGGGGAAGGTTGGGCGAAGG - Intergenic
1036767650 8:11558895-11558917 TACTGGGTAAGGCTGGGCGAGGG - Intronic
1038535917 8:28352720-28352742 CACTGGGTAAGGTTGAGCGAGGG - Intronic
1039033120 8:33331050-33331072 TACTGAGTAGGGCTGGGCATGGG + Intergenic
1043889967 8:85643918-85643940 AACTCGGTAAGGATGGACGACGG + Intergenic
1043891505 8:85655832-85655854 AACTCGGTAAGGATGGACGACGG + Intergenic
1044678999 8:94758253-94758275 TACTGGGGGAAGCTGGGTGAGGG - Intronic
1049861445 8:144901732-144901754 GAGCGGGTAAGGCTCGGCGATGG - Intronic
1052881471 9:33603261-33603283 TACAGGGTAAGGCTGGGGAGAGG - Intergenic
1053494847 9:38542578-38542600 TACAGGGTAAGGCTGGGGAGAGG + Exonic
1059769747 9:117414480-117414502 CCCTGGGTAAGGCTGGGCGCCGG - Exonic
1062394520 9:136347404-136347426 GACTGGGTAAGGGTGGGCATAGG + Intronic
1062511890 9:136910798-136910820 AAATGGGTAGGGCTGGGGGACGG + Intronic
1186977126 X:14919540-14919562 TACTCTGTAAGGCTGGTGGAAGG - Intronic
1190108000 X:47572928-47572950 TCCTGGCTAAGGCTGGGCCTGGG + Exonic
1190710807 X:53068195-53068217 TAATTGGTAAGTCTGGGCAATGG + Intronic
1194116888 X:89911322-89911344 TACTGGGGAATACTGGGTGAGGG + Intergenic
1197487423 X:127071085-127071107 TTGGGGGTAAGGCTGGGAGAGGG - Intergenic
1199982874 X:152930499-152930521 TCCTGGGGACAGCTGGGCGAGGG + Intronic
1200469682 Y:3568490-3568512 TACTGGGGAATACTGGGTGAGGG + Intergenic
1201189857 Y:11436892-11436914 TGCAGGGTAAGGCAGGGCAATGG - Intergenic